Morpholino

MO4-swap70b

ID
ZDB-MRPHLNO-140306-3
Name
MO4-swap70b
Previous Names
  • splice donor site of exon 1 (1)
Target
Sequence
5' - AGAGCAAAACGACAAACCTTCAGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-swap70b
No data available
Phenotype
Phenotype resulting from MO4-swap70b
Phenotype Fish Figures
convergent extension involved in gastrulation disrupted, abnormal WT + MO4-swap70b Fig. 4 with image from Xu et al., 2014
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO4-swap70b Fig. 5 with image from Xu et al., 2014
embryo development disrupted, abnormal WT + MO4-swap70b Fig. 2 with image from Xu et al., 2014
polster increased distance notochord, abnormal WT + MO4-swap70b Fig. 4 with image from Xu et al., 2014
post-vent region curved, abnormal WT + MO4-swap70b Fig. 4 with image from Xu et al., 2014
prechordal plate morphology, abnormal WT + MO4-swap70b Fig. 10 with image from Xu et al., 2014
whole organism dead, abnormal WT + MO4-swap70b Fig. 2 with image from Xu et al., 2014
whole organism anterior-most region increased angle to whole organism posterior-most region, abnormal WT + MO4-swap70b Fig. 3 with image from Xu et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO4-swap70b Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Xu et al., 2014
Phenotype of all Fish created by or utilizing MO4-swap70b
Phenotype Fish Conditions Figures
convergent extension involved in gastrulation disrupted, abnormal WT + MO4-swap70b standard conditions Fig. 4 with image from Xu et al., 2014
polster increased distance notochord, abnormal WT + MO4-swap70b standard conditions Fig. 4 with image from Xu et al., 2014
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO4-swap70b standard conditions Fig. 5 with image from Xu et al., 2014
whole organism anterior-most region increased angle to whole organism posterior-most region, abnormal WT + MO4-swap70b standard conditions Fig. 3 with image from Xu et al., 2014
whole organism dead, abnormal WT + MO4-swap70b standard conditions Fig. 2 with image from Xu et al., 2014
prechordal plate morphology, abnormal WT + MO4-swap70b standard conditions Fig. 10 with image from Xu et al., 2014
embryo development disrupted, abnormal WT + MO4-swap70b standard conditions Fig. 2 with image from Xu et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO4-swap70b standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Xu et al., 2014
post-vent region curved, abnormal WT + MO4-swap70b standard conditions Fig. 4 with image from Xu et al., 2014
prechordal plate morphology, abnormal WT + MO1-def6a + MO4-swap70b standard conditions Fig. 10 with image from Xu et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.