Morpholino

MO4-stil

ID
ZDB-MRPHLNO-140117-6
Name
MO4-stil
Previous Names
  • anti‐stil splice Mo (1)
Target
Sequence
5' - GAGTCGTCCTGAAAGAATAAAGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-stil
No data available
Phenotype
Phenotype resulting from MO4-stil
Phenotype Fish Figures
eye decreased size, abnormal WT + MO4-stil Fig. 2 with image from Novorol et al., 2013
retina decreased size, abnormal WT + MO4-stil Fig. 2 with image from Novorol et al., 2013
retina has fewer parts of type retina cell, abnormal WT + MO4-stil Fig. 2 with image,  Fig. 3 with image from Novorol et al., 2013
retina cell division increased duration, abnormal WT + MO4-stil Fig. 4 with image from Novorol et al., 2013
retina M phase increased duration, abnormal WT + MO4-stil Fig. 4 with image from Novorol et al., 2013
retina mitotic cell cycle arrested, abnormal WT + MO4-stil Fig. 4 with image from Novorol et al., 2013
retina mitotic cell cycle increased duration, abnormal WT + MO4-stil Fig. 4 with image from Novorol et al., 2013
retina mitotic cell cycle increased occurrence, abnormal WT + MO4-stil Fig. 3 with image from Novorol et al., 2013
retina mitotic M phase increased duration, abnormal WT + MO4-stil Fig. 4 with image from Novorol et al., 2013
retina mitotic prometaphase arrested, abnormal WT + MO4-stil Fig. 4 with image from Novorol et al., 2013
retina mitotic prometaphase increased duration, abnormal WT + MO4-stil Fig. 4 with image from Novorol et al., 2013
spinal cord mitotic cell cycle increased occurrence, abnormal WT + MO4-stil Fig. 3 with image from Novorol et al., 2013
Phenotype of all Fish created by or utilizing MO4-stil
Phenotype Fish Conditions Figures
eye decreased size, abnormal WT + MO4-stil standard conditions Fig. 2 with image from Novorol et al., 2013
retina mitotic prometaphase arrested, abnormal WT + MO4-stil standard conditions Fig. 4 with image from Novorol et al., 2013
retina mitotic cell cycle increased occurrence, abnormal WT + MO4-stil standard conditions Fig. 3 with image from Novorol et al., 2013
retina has fewer parts of type retina cell, abnormal WT + MO4-stil standard conditions Fig. 2 with image,  Fig. 3 with image from Novorol et al., 2013
retina cell division increased duration, abnormal WT + MO4-stil standard conditions Fig. 4 with image from Novorol et al., 2013
spinal cord mitotic cell cycle increased occurrence, abnormal WT + MO4-stil standard conditions Fig. 3 with image from Novorol et al., 2013
retina M phase increased duration, abnormal WT + MO4-stil standard conditions Fig. 4 with image from Novorol et al., 2013
retina decreased size, abnormal WT + MO4-stil standard conditions Fig. 2 with image from Novorol et al., 2013
retina mitotic prometaphase increased duration, abnormal WT + MO4-stil standard conditions Fig. 4 with image from Novorol et al., 2013
retina mitotic cell cycle increased duration, abnormal WT + MO4-stil standard conditions Fig. 4 with image from Novorol et al., 2013
retina mitotic cell cycle arrested, abnormal WT + MO4-stil standard conditions Fig. 4 with image from Novorol et al., 2013
retina mitotic M phase increased duration, abnormal WT + MO4-stil standard conditions Fig. 4 with image from Novorol et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.