Morpholino

MO3-chn1

ID

ZDB-MRPHLNO-140113-2

Name

MO3-chn1

Previous Names

None

Target

Sequence

5' - GAGGACTCACCGAACACATGGATGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-chn1

Expressed Gene	Anatomy	Figures
chn1	whole organism	Fig. 5 from Carretero-Rodriguez et al., 2021

Phenotype

Phenotype resulting from MO3-chn1

Phenotype	Fish	Figures
cranial nerve III axon defasciculated, abnormal	AB + MO3-chn1	Fig. 5 from Carretero-Rodriguez et al., 2021
cranial nerve III axon increased branchiness, abnormal	AB + MO3-chn1	Fig. 5 from Carretero-Rodriguez et al., 2021
cranial nerve III axon mislocalised, abnormal	WT + MO3-chn1	Fig. 5 from Clark et al., 2013
cranial nerve III axon extension process quality, abnormal	WT + MO3-chn1	Fig. 5 from Clark et al., 2013
cranial nerve III oculomotor nerve development decreased process quality, abnormal	AB + MO3-chn1	Fig. 5 from Carretero-Rodriguez et al., 2021
oculomotor nerve formation decreased process quality, abnormal	WT + MO3-chn1	Fig. 5 from Clark et al., 2013
optomotor response decreased process quality, abnormal	WT + MO3-chn1	Fig. 9 from Carretero-Rodriguez et al., 2021 Fig. T3 from Clark et al., 2013
whole organism chn1 expression decreased amount, abnormal	AB + MO3-chn1	Fig. 5 from Carretero-Rodriguez et al., 2021

Phenotype of all Fish created by or utilizing MO3-chn1

Phenotype	Fish	Conditions	Figures
whole organism chn1 expression decreased amount, abnormal	AB + MO3-chn1	standard conditions	Fig. 5 from Carretero-Rodriguez et al., 2021
optomotor response decreased process quality, abnormal	AB + MO3-chn1	standard conditions	Fig. 9 from Carretero-Rodriguez et al., 2021
cranial nerve III axon increased branchiness, abnormal	AB + MO3-chn1	standard conditions	Fig. 5 from Carretero-Rodriguez et al., 2021
cranial nerve III axon defasciculated, abnormal	AB + MO3-chn1	standard conditions	Fig. 5 from Carretero-Rodriguez et al., 2021
cranial nerve III oculomotor nerve development decreased process quality, abnormal	AB + MO3-chn1	standard conditions	Fig. 5 from Carretero-Rodriguez et al., 2021
cranial nerve III axon mislocalised, abnormal	WT + MO3-chn1	standard conditions	Fig. 5 from Clark et al., 2013
cranial nerve III axon extension process quality, abnormal	WT + MO3-chn1	standard conditions	Fig. 5 from Clark et al., 2013
oculomotor nerve formation decreased process quality, abnormal	WT + MO3-chn1	standard conditions	Fig. 5 from Clark et al., 2013
optomotor response decreased process quality, abnormal	WT + MO3-chn1	standard conditions	Fig. T3 from Clark et al., 2013

Citations