Morpholino

MO3-bbs2

ID
ZDB-MRPHLNO-131205-1
Name
MO3-bbs2
Previous Names
None
Target
Sequence
5' - GATGGGCACTAGCATTGTGGCTCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bbs2
No data available
Phenotype
Phenotype resulting from MO3-bbs2
Phenotype Fish Figures
cell migration involved in gastrulation disrupted, abnormal WT + MO3-bbs2 Fig. S3 with image from Zaghloul et al., 2010
convergent extension process quality, abnormal WT + MO3-bbs2 Fig. 5 from Lindstrand et al., 2014
gastrulation disrupted, abnormal WT + MO3-bbs2 Fig. S4 with image from Zaghloul et al., 2010
notochord increased width, abnormal WT + MO3-bbs2 Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image from Zaghloul et al., 2010
notochord kinked, abnormal WT + MO3-bbs2 Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
pronephric proximal convoluted tubule morphology, abnormal WT + MO3-bbs2 Fig. 5 from Lindstrand et al., 2014
pronephros development disrupted, abnormal WT + MO3-bbs2 Fig. 5 from Lindstrand et al., 2014
somite increased width, abnormal WT + MO3-bbs2 Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-bbs2 Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
Phenotype of all Fish created by or utilizing MO3-bbs2
Phenotype Fish Conditions Figures
somite increased width, abnormal WT + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
cell migration involved in gastrulation disrupted, abnormal WT + MO3-bbs2 standard conditions Fig. S3 with image from Zaghloul et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
pronephros development disrupted, abnormal WT + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image from Zaghloul et al., 2010
convergent extension process quality, abnormal WT + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
Fig. 4 with image,  Fig. S4 with image from Zaghloul et al., 2010
gastrulation disrupted, abnormal WT + MO3-bbs2 standard conditions Fig. S4 with image from Zaghloul et al., 2010
pronephric proximal convoluted tubule morphology, abnormal WT + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
whole organism lacks all parts of type optic vesicle, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
somite increased width, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
somite amorphous, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
notochord kinked, abnormal WT + MO1-bbs1 + MO3-bbs2 standard conditions Fig. 4 with image from Zaghloul et al., 2010
pronephros development disrupted, abnormal WT + MO2-nphp1 + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-nphp1 + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO2-nphp1 + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
somite increased width, abnormal WT + MO2-nphp1 + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
convergent extension process quality, abnormal WT + MO2-nphp1 + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
pronephric proximal convoluted tubule morphology, abnormal WT + MO2-nphp1 + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO2-nphp1 + MO3-bbs2 standard conditions Fig. 5 from Lindstrand et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.