Morpholino

MO1-hs3st1l2

ID
ZDB-MRPHLNO-131108-6
Name
MO1-hs3st1l2
Previous Names
  • 3-OST-5 MO1, Translational start site (1)
Target
Sequence
5' - GTCCAGTCAGGTCAAGGGCAGCTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hs3st1l2
Expressed Gene Anatomy Figures
dnah9 Fig. 3 with image from Neugebauer et al., 2013
foxa3 Fig. S1 with image from Neugebauer et al., 2013
foxj1a Fig. 3 with image from Neugebauer et al., 2013
il17rd Fig. 3 with image from Neugebauer et al., 2013
kif3b Fig. 5 with image from Neugebauer et al., 2013
lft1 Fig. S1 with image from Neugebauer et al., 2013
myl7 Fig. S1 with image from Neugebauer et al., 2013
rfx2 Fig. 3 with image from Neugebauer et al., 2013
shha Fig. S1 with image from Neugebauer et al., 2013
spaw Fig. 1 with image from Neugebauer et al., 2013
Phenotype
Phenotype resulting from MO1-hs3st1l2
Phenotype Fish Figures
gut left/right pattern formation process quality, abnormal WT + MO1-hs3st1l2 Fig. 1 with image,  Fig. S1 with image from Neugebauer et al., 2013
heart looping process quality, abnormal twu34Tg + MO1-hs3st1l2 Fig. 1 with image,  Fig. S1 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium decreased speed, abnormal WT + MO1-hs3st1l2 Fig. 2 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium shortened, abnormal WT + MO1-hs3st1l2 Fig. 2 with image from Neugebauer et al., 2013
left/right pattern formation process quality, abnormal WT + MO1-hs3st1l2 Fig. 1 with image,  Fig. S1 with image from Neugebauer et al., 2013
whole organism curved, abnormal WT + MO1-hs3st1l2 Fig. 1 with image from Neugebauer et al., 2013
Phenotype of all Fish created by or utilizing MO1-hs3st1l2
Phenotype Fish Conditions Figures
whole organism curved, abnormal WT + MO1-hs3st1l2 standard conditions Fig. 1 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium shortened, abnormal WT + MO1-hs3st1l2 standard conditions Fig. 2 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium decreased speed, abnormal WT + MO1-hs3st1l2 standard conditions Fig. 2 with image from Neugebauer et al., 2013
heart looping process quality, abnormal WT + MO1-hs3st1l2 standard conditions Fig. 1 with image,  Fig. S1 with image from Neugebauer et al., 2013
left/right pattern formation process quality, abnormal WT + MO1-hs3st1l2 standard conditions Fig. 1 with image,  Fig. S1 with image from Neugebauer et al., 2013
gut left/right pattern formation process quality, abnormal WT + MO1-hs3st1l2 standard conditions Fig. 1 with image,  Fig. S1 with image from Neugebauer et al., 2013
heart looping process quality, abnormal twu34Tg + MO1-hs3st1l2 standard conditions Fig. 1 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium shortened, abnormal fgf8ati282a/ti282a + MO1-hs3st1l2 standard conditions Fig. 3 with image from Neugebauer et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.