Morpholino

MO3-spast

ID
ZDB-MRPHLNO-131010-1
Name
MO3-spast
Previous Names
None
Target
Sequence
5' - ATTCATTCACCCTTCTCGGGCTCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-spast
No data available
Phenotype
Phenotype resulting from MO3-spast
Phenotype Fish Figures
axon extension disrupted, abnormal AB + MO3-spast Fig. 8 from Allison et al., 2013
caudal fin curved, abnormal WT + MO3-spast Fig. 2 with image from Jardin et al., 2018
extension morphology, abnormal WT + MO3-spast Fig. 9 from Julien et al., 2016
head hydrocephalic, abnormal WT + MO3-spast Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, abnormal WT + MO3-spast Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, abnormal WT + MO3-spast Fig. 9 from Julien et al., 2016
secondary motor neuron axon guidance process quality, abnormal ml2Tg + MO3-spast Fig. 3 with image,  Fig. 6 with image from Jardin et al., 2018
spinal cord microtubule cytoskeleton disorganized, abnormal WT + MO3-spast Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, abnormal WT + MO3-spast Fig. 9 from Julien et al., 2016
spinal cord motor neuron branchiness, abnormal AB + MO3-spast Fig. 8 from Allison et al., 2013
spinal cord motor neuron truncated, abnormal AB + MO3-spast Fig. 8 from Allison et al., 2013
thigmotaxis process quality, abnormal WT + MO3-spast Fig. 2 with image from Jardin et al., 2018
whole organism arched, abnormal WT + MO3-spast Fig. 9 from Julien et al., 2016
whole organism decreased mobility, abnormal AB + MO3-spast Fig. 8 from Allison et al., 2013
whole organism increased curvature, abnormal AB + MO3-spast Fig. 8 from Allison et al., 2013
Phenotype of all Fish created by or utilizing MO3-spast
Phenotype Fish Conditions Figures
whole organism decreased mobility, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
spinal cord motor neuron truncated, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
axon extension disrupted, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
spinal cord motor neuron branchiness, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
whole organism increased curvature, abnormal AB + MO3-spast standard conditions Fig. 8 from Allison et al., 2013
whole organism arched, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
secondary motor neuron axon guidance process quality, abnormal WT + MO3-spast control Fig. 6 with image from Jardin et al., 2018
head hydrocephalic, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
whole organism arched, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
extension morphology, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
head hydrocephalic, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
head hydrocephalic, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
caudal fin curved, abnormal WT + MO3-spast control Fig. 2 with image from Jardin et al., 2018
motor neuron axon microtubule bundle decreased diameter, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
extension morphology, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
head hydrocephalic, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
extension morphology, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
whole organism arched, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
whole organism arched, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
extension morphology, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
thigmotaxis process quality, abnormal WT + MO3-spast control Fig. 2 with image from Jardin et al., 2018
whole organism arched, ameliorated WT + MO3-spast chemical treatment: Guanabenz Fig. 9 from Julien et al., 2016
extension morphology, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
motor neuron axon microtubule bundle decreased diameter, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, abnormal WT + MO3-spast standard conditions Fig. 9 from Julien et al., 2016
head hydrocephalic, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton disorganized, ameliorated WT + MO3-spast chemical treatment: phenazine Fig. 9 from Julien et al., 2016
spinal cord microtubule cytoskeleton organization disrupted, ameliorated WT + MO3-spast chemical treatment: salubrinal Fig. 9 from Julien et al., 2016
reactive oxygen species metabolic process process quality, ameliorated WT + MO3-spast chemical treatment: methylene blue Fig. 9 from Julien et al., 2016
secondary motor neuron axon guidance process quality, abnormal ml2Tg + MO3-spast control Fig. 3 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, exacerbated ml2Tg + MO1-atl1 + MO3-spast control Fig. 6 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, ameliorated w30Tg + MO3-spast heat shock Fig. 6 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, abnormal w30Tg + MO3-spast control Fig. 6 with image from Jardin et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.