Morpholino

MO2-adgra3

ID
ZDB-MRPHLNO-131003-5
Name
MO2-adgra3
Previous Names
None
Target
Sequence
5' - TAGCATATAAATAGCCTTTCCGTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-adgra3
No data available
Phenotype
Phenotype resulting from MO2-adgra3
No data available
Phenotype of all Fish created by or utilizing MO2-adgra3
Phenotype Fish Conditions Figures
axial mesoderm increased width, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
paraxial mesoderm shortened, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
whole organism anterior-posterior axis shortened, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 2 with image from Li et al., 2013
neuroectoderm shortened, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
eye fused with eye, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 2 with image from Li et al., 2013
axial mesoderm shortened, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
neuroectoderm increased width, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
notochord cell misaligned towards notochord medial-lateral axis, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
paraxial mesoderm increased width, abnormal scribrw468/rw468 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
axial mesoderm increased width, abnormal vangl2vu67/vu67 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
notochord cell misaligned towards notochord medial-lateral axis, abnormal vangl2vu67/vu67 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
paraxial mesoderm shortened, abnormal vangl2vu67/vu67 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
neuroectoderm increased width, abnormal vangl2vu67/vu67 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
axial mesoderm shortened, abnormal vangl2vu67/vu67 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
paraxial mesoderm increased width, abnormal vangl2vu67/vu67 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
neuroectoderm shortened, abnormal vangl2vu67/vu67 + MO2-adgra3 standard conditions Fig. 3 with image from Li et al., 2013
eye fused with eye, abnormal wnt11f2tz216/tz216 + MO2-adgra3 standard conditions Fig. 2 with image from Li et al., 2013
branchiomotor neuron located in rhombomere 4, abnormal scribrw468/+; rw0Tg + MO2-adgra3 standard conditions Fig. 4 with image from Li et al., 2013
motor neuron migration disrupted, abnormal scribrw468/+; rw0Tg + MO2-adgra3 standard conditions Fig. 4 with image from Li et al., 2013
motor neuron migration disrupted, abnormal vangl2vu67/+; rw0Tg + MO2-adgra3 standard conditions Fig. 4 with image from Li et al., 2013
branchiomotor neuron located in rhombomere 4, abnormal vangl2vu67/+; rw0Tg + MO2-adgra3 standard conditions Fig. 4 with image from Li et al., 2013
Citations