Morpholino

MO1-lhx3

ID

ZDB-MRPHLNO-130401-3

Name

MO1-lhx3

Previous Names

None

Target

lhx3 (1)

Sequence

5' - GTTCTAACAACATTCTGGCGATAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lhx3

Expressed Gene	Anatomy	Figures
syt2b	CaP motoneuron axon MiP motor neuron axon	Fig. 3 from Seredick et al., 2014

Phenotype

Phenotype resulting from MO1-lhx3

No data available

Phenotype of all Fish created by or utilizing MO1-lhx3

Phenotype	Fish	Conditions	Figures
primary motor neuron spinal cord motor neuron cell fate specification decreased occurrence, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 5 from Seredick et al., 2014
secondary motor neuron axon extension decreased occurrence, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 3 from Seredick et al., 2014
Kolmer-Agduhr neuron ventral spinal cord interneuron specification increased occurrence, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 5 from Seredick et al., 2014
primary motor neuron axon morphology, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 3 from Seredick et al., 2014
ventral spinal nerve has fewer parts of type CaP motoneuron axon, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 3 from Seredick et al., 2014
secondary motor neuron axon morphology, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 3 from Seredick et al., 2014
primary motor neuron axon extension decreased occurrence, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 3 from Seredick et al., 2014
primary motor neuron ventral spinal cord interneuron specification increased occurrence, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 5 from Seredick et al., 2014
ventral spinal nerve has fewer parts of type secondary motor neuron axon, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 3 from Seredick et al., 2014
ventral spinal nerve decreased diameter, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 3 from Seredick et al., 2014
swimming decreased occurrence, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	text only from Seredick et al., 2014
spinal cord has fewer parts of type primary motor neuron, abnormal	WT + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 5 from Seredick et al., 2014
spinal cord has fewer parts of type CiD, abnormal	nns1Tg + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 7 from Seredick et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal	nns1Tg + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 7 from Seredick et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal	nns5Tg + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 7 from Seredick et al., 2014
spinal cord has fewer parts of type VeLD, abnormal	nns5Tg + MO1-lhx3 + MO1-lhx4	standard conditions	Fig. 7 from Seredick et al., 2014

Citations