Morpholino

MO1-alx1

ID
ZDB-MRPHLNO-130227-1
Name
MO1-alx1
Previous Names
  • alx1i1e2 (1)
Target
Sequence
5' - CACGCCTGAGGAGGTCACAGAAAAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-alx1
Expressed Gene Anatomy Figures
alx3 Fig. 7 from Dee et al., 2013
foxd3 Fig. 5 from Dee et al., 2013
myod1 Fig. 5 from Dee et al., 2013
sox10 Fig. 5,  Fig. 7 from Dee et al., 2013
Phenotype
Phenotype resulting from MO1-alx1
Phenotype Fish Figures
ceratobranchial cartilage absent, abnormal WT + MO1-alx1 Fig. 4 from Dee et al., 2013
cornea disorganized, abnormal WT + MO1-alx1 Fig. 3 from Dee et al., 2013
cranial neural crest physical object quality, abnormal ba2Tg + MO1-alx1 Fig. 5,  Fig. 6 from Dee et al., 2013
cranial neural crest cell mislocalised, abnormal ba2Tg + MO1-alx1 Fig. 7 from Dee et al., 2013
embryonic camera-type eye morphogenesis decreased process quality, abnormal WT + MO1-alx1 Fig. 3 from Dee et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal WT + MO1-alx1 Fig. 4,  Fig. 7 from Dee et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO1-alx1 Fig. 3,  Fig. 4 from Dee et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO1-alx1 Fig. 4 from Dee et al., 2013
eye decreased size, abnormal WT + MO1-alx1 Fig. 3 from Dee et al., 2013
head decreased size, abnormal WT + MO1-alx1 Fig. 3 from Dee et al., 2013
heart edematous, abnormal WT + MO1-alx1 Fig. 3 from Dee et al., 2013
lens decreased size, abnormal WT + MO1-alx1 Fig. 3 from Dee et al., 2013
mandibular arch skeleton absent, abnormal WT + MO1-alx1 Fig. 3 from Dee et al., 2013
Meckel's cartilage absent, abnormal WT + MO1-alx1 Fig. 4 from Dee et al., 2013
neural crest cell development decreased process quality, abnormal WT + MO1-alx1 Fig. 5 from Dee et al., 2013
neural crest cell migration decreased process quality, abnormal ba2Tg + MO1-alx1 Fig. 6,  Fig. 7 from Dee et al., 2013
neurocranial trabecula absent, abnormal WT + MO1-alx1 Fig. 7 from Dee et al., 2013
neurocranial trabecula decreased size, abnormal WT + MO1-alx1 Fig. 4 from Dee et al., 2013
palatoquadrate cartilage absent, abnormal WT + MO1-alx1 Fig. 4 from Dee et al., 2013
retinal photoreceptor layer disorganized, abnormal WT + MO1-alx1 Fig. 3 from Dee et al., 2013
Phenotype of all Fish created by or utilizing MO1-alx1
Phenotype Fish Conditions Figures
ethmoid cartilage decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 4,  Fig. 7 from Dee et al., 2013
mandibular arch skeleton absent, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
neural crest cell migration decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 7 from Dee et al., 2013
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 3,  Fig. 4 from Dee et al., 2013
neurocranial trabecula decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
neural crest cell development decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 5 from Dee et al., 2013
head decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
palatoquadrate cartilage absent, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
Meckel's cartilage absent, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
cranial neural crest physical object quality, abnormal WT + MO1-alx1 standard conditions Fig. 5 from Dee et al., 2013
retinal photoreceptor layer disorganized, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
ceratobranchial cartilage absent, abnormal WT + MO1-alx1 standard conditions Fig. 4 from Dee et al., 2013
embryonic camera-type eye morphogenesis decreased process quality, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
heart edematous, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
eye decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
neurocranial trabecula absent, abnormal WT + MO1-alx1 standard conditions Fig. 7 from Dee et al., 2013
cranial neural crest cell mislocalised, abnormal WT + MO1-alx1 standard conditions Fig. 7 from Dee et al., 2013
cornea disorganized, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
lens decreased size, abnormal WT + MO1-alx1 standard conditions Fig. 3 from Dee et al., 2013
cranial neural crest physical object quality, abnormal ba2Tg + MO1-alx1 standard conditions Fig. 6 from Dee et al., 2013
neural crest cell migration decreased process quality, abnormal ba2Tg + MO1-alx1 standard conditions Fig. 6,  Fig. 7 from Dee et al., 2013
cranial neural crest cell mislocalised, abnormal ba2Tg + MO1-alx1 standard conditions Fig. 7 from Dee et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.