Morpholino

MO2-ptprb

ID
ZDB-MRPHLNO-130128-2
Name
MO2-ptprb
Previous Names
  • zve-ptp MOb (1)
Target
Sequence
5' - AGGGCTCTGAAACACACACAAACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ptprb
No data available
Phenotype
Phenotype resulting from MO2-ptprb
Phenotype Fish Figures
adherens junction assembly disrupted, abnormal AB + MO2-ptprb Fig. 5 with image,  Fig. S5 with image from Carra et al., 2012
blood circulation disrupted, abnormal AB + MO2-ptprb Fig. 3 with image from Carra et al., 2012
blood vessel endothelial cell has fewer parts of type blood vessel endothelial cell cell-cell junction, abnormal AB + MO2-ptprb Fig. 5 with image,  Fig. S5 with image from Carra et al., 2012
blood vessel endothelial cell adherens junction immature, abnormal AB + MO2-ptprb Fig. 5 with image,  Fig. S5 with image from Carra et al., 2012
caudal vein increased permeability, abnormal y1Tg + MO2-ptprb Fig. 4 with image from Carra et al., 2012
caudal vein plexus broken, abnormal AB + MO2-ptprb Fig. 3 with image from Carra et al., 2012
caudal vein plexus disorganized, abnormal AB + MO2-ptprb Fig. 3 with image from Carra et al., 2012
caudal vein plexus increased accumulation blood, abnormal AB + MO2-ptprb Fig. 3 with image from Carra et al., 2012
dorsal longitudinal anastomotic vessel increased permeability, abnormal y1Tg + MO2-ptprb Fig. 4 with image from Carra et al., 2012
head hemorrhagic, abnormal AB + MO2-ptprb Fig. 3 with image from Carra et al., 2012
Phenotype of all Fish created by or utilizing MO2-ptprb
Phenotype Fish Conditions Figures
blood vessel endothelial cell adherens junction immature, abnormal AB + MO2-ptprb standard conditions Fig. 5 with image,  Fig. S5 with image from Carra et al., 2012
blood vessel endothelial cell has fewer parts of type blood vessel endothelial cell cell-cell junction, abnormal AB + MO2-ptprb standard conditions Fig. 5 with image,  Fig. S5 with image from Carra et al., 2012
head hemorrhagic, abnormal AB + MO2-ptprb standard conditions Fig. 3 with image from Carra et al., 2012
caudal vein plexus increased accumulation blood, abnormal AB + MO2-ptprb standard conditions Fig. 3 with image from Carra et al., 2012
adherens junction assembly disrupted, abnormal AB + MO2-ptprb standard conditions Fig. 5 with image,  Fig. S5 with image from Carra et al., 2012
caudal vein plexus disorganized, abnormal AB + MO2-ptprb standard conditions Fig. 3 with image from Carra et al., 2012
blood circulation disrupted, abnormal AB + MO2-ptprb standard conditions Fig. 3 with image from Carra et al., 2012
caudal vein plexus broken, abnormal AB + MO2-ptprb standard conditions Fig. 3 with image from Carra et al., 2012
dorsal longitudinal anastomotic vessel increased permeability, abnormal y1Tg + MO2-ptprb standard conditions Fig. 4 with image from Carra et al., 2012
caudal vein increased permeability, abnormal y1Tg + MO2-ptprb standard conditions Fig. 4 with image from Carra et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.