Morpholino

MO4-fbxo5

ID
ZDB-MRPHLNO-121203-1
Name
MO4-fbxo5
Previous Names
  • emi1 MO (1)
Target
Sequence
5' - ATTGTCGTTTCACCTCATCATCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-fbxo5
No data available
Phenotype
Phenotype resulting from MO4-fbxo5
Phenotype Fish Figures
caudal fin curved ventral, abnormal WT + MO4-fbxo5 Fig. 2 with image from Robu et al., 2012
cell increased size, abnormal WT + MO4-fbxo5 + MO4-tp53 Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
cell cycle process quality, abnormal WT + MO4-fbxo5 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
cell death increased process quality, abnormal WT + MO4-fbxo5 Fig. 3 with image from Robu et al., 2012
head decreased size, abnormal WT + MO4-fbxo5 Fig. 2 with image from Robu et al., 2012
head cell death increased process quality, abnormal WT + MO4-fbxo5 Fig. 2 with image from Robu et al., 2012
somite deformed, abnormal WT + MO4-fbxo5 Fig. 2 with image from Robu et al., 2012
whole organism cell endopolyploid, abnormal WT + MO4-fbxo5 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
whole organism cell polyploid, abnormal WT + MO4-fbxo5 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
whole organism cell tetraploid, abnormal WT + MO4-fbxo5 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
Phenotype of all Fish created by or utilizing MO4-fbxo5
Phenotype Fish Conditions Figures
caudal fin curved ventral, abnormal WT + MO4-fbxo5 standard conditions Fig. 2 with image from Robu et al., 2012
whole organism cell polyploid, abnormal WT + MO4-fbxo5 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
cell increased size, abnormal WT + MO4-fbxo5 standard conditions Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
whole organism cell tetraploid, abnormal WT + MO4-fbxo5 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
head cell death increased process quality, abnormal WT + MO4-fbxo5 standard conditions Fig. 2 with image from Robu et al., 2012
somite deformed, abnormal WT + MO4-fbxo5 standard conditions Fig. 2 with image from Robu et al., 2012
head decreased size, abnormal WT + MO4-fbxo5 standard conditions Fig. 2 with image from Robu et al., 2012
whole organism cell endopolyploid, abnormal WT + MO4-fbxo5 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
cell death increased process quality, abnormal WT + MO4-fbxo5 standard conditions Fig. 3 with image from Robu et al., 2012
cell cycle process quality, abnormal WT + MO4-fbxo5 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Robu et al., 2012
cell increased size, abnormal WT + MO4-fbxo5 + MO4-tp53 standard conditions Fig. 3 with image from Robu et al., 2012
cell cycle process quality, abnormal WT + MO1-cdt1 + MO4-fbxo5 standard conditions Fig. 3 with image from Robu et al., 2012
cell death increased process quality, abnormal WT + MO1-cdt1 + MO4-fbxo5 standard conditions Fig. 3 with image from Robu et al., 2012
whole organism cell endopolyploid, abnormal WT + MO1-cdt1 + MO4-fbxo5 standard conditions Fig. 3 with image from Robu et al., 2012
whole organism cell polyploid, abnormal WT + MO1-cdt1 + MO4-fbxo5 standard conditions Fig. 3 with image from Robu et al., 2012
whole organism cell tetraploid, abnormal WT + MO1-cdt1 + MO4-fbxo5 standard conditions Fig. 3 with image from Robu et al., 2012
cell increased size, abnormal WT + MO1-cdt1 + MO4-fbxo5 standard conditions Fig. 3 with image from Robu et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.