Morpholino

MO1-flnca

ID

ZDB-MRPHLNO-121018-2

Name

MO1-flnca

Previous Names

None

Target

flnca (1)

Sequence

5' - CATGGTGGGACTGCTGCTTTTATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-flnca

No data available

Phenotype

Phenotype resulting from MO1-flnca

Phenotype	Fish	Figures
slow muscle cell non-functional, abnormal	WT + MO1-flnca	Fig. 4 from Ruparelia et al., 2012
slow muscle cell actin filament irregular spatial pattern, abnormal	WT + MO1-flnca	Fig. 7 from Ruparelia et al., 2012
slow muscle cell myosin filament irregular spatial pattern, abnormal	WT + MO1-flnca	Fig. 7 from Ruparelia et al., 2012
slow muscle cell type III intermediate filament irregular spatial pattern, abnormal	WT + MO1-flnca	Fig. 7 from Ruparelia et al., 2012
somite border myosin complex aggregated, abnormal	WT + MO1-flnca	Fig. 4, Fig. 7 from Ruparelia et al., 2012

Phenotype of all Fish created by or utilizing MO1-flnca

Phenotype	Fish	Conditions	Figures
slow muscle cell actin filament irregular spatial pattern, abnormal	WT + MO1-flnca	standard conditions	Fig. 7 from Ruparelia et al., 2012
slow muscle cell myosin filament irregular spatial pattern, abnormal	WT + MO1-flnca	standard conditions	Fig. 7 from Ruparelia et al., 2012
slow muscle cell non-functional, abnormal	WT + MO1-flnca	standard conditions	Fig. 4 from Ruparelia et al., 2012
somite border myosin complex aggregated, abnormal	WT + MO1-flnca	standard conditions	Fig. 4, Fig. 7 from Ruparelia et al., 2012
slow muscle cell type III intermediate filament irregular spatial pattern, abnormal	WT + MO1-flnca	standard conditions	Fig. 7 from Ruparelia et al., 2012
striated muscle cell muscle myosin complex accumulation myoseptum, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 3 from Ruparelia et al., 2016
somite border ab-a4.1025 labeling mislocalised, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 3, Fig. 4 from Ruparelia et al., 2016
somite border myosin complex aggregated, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 7 from Ruparelia et al., 2012
slow muscle cell myosin filament irregular spatial pattern, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 7 from Ruparelia et al., 2012
muscle cell cellular homeostasis disrupted, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	text only from Ruparelia et al., 2012
slow muscle cell actin filament irregular spatial pattern, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 7 from Ruparelia et al., 2012
slow muscle cell non-functional, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 4 from Ruparelia et al., 2012
fast muscle cell contractile muscle fiber disassembled, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 5 from Ruparelia et al., 2012
skeletal muscle cell ab-a4.1025 labeling spatial pattern, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 3, Fig. 4 from Ruparelia et al., 2016
slow muscle cell broken, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 4, Fig. 5 from Ruparelia et al., 2012
skeletal muscle cell broken, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 3, Fig. 4 from Ruparelia et al., 2016
striated muscle cell mitochondrion infiltrative, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 3 from Ruparelia et al., 2016
slow muscle cell type III intermediate filament irregular spatial pattern, abnormal	WT + MO1-flnca + MO2-flncb	standard conditions	Fig. 7 from Ruparelia et al., 2012

Citations