Morpholino

MO4-rbm24a

ID
ZDB-MRPHLNO-121001-2
Name
MO4-rbm24a
Previous Names
  • e1i1 (1)
Target
Sequence
5' - CACAAGAGGAATACTTACAAATCCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-rbm24a
Expressed Gene Anatomy Figures
rbm24a Fig. 3 from Poon et al., 2012
Phenotype
Phenotype resulting from MO4-rbm24a
Phenotype Fish Figures
atrium dilated, abnormal WT + MO4-rbm24a Fig. S3 from Poon et al., 2012
blood circulation disrupted, abnormal WT + MO4-rbm24a Fig. 3,  Fig. S3,  text only from Poon et al., 2012
cardiac muscle cell decreased size, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell myofibril sparse, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell sarcomere increased length, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell striated muscle myosin thick filament disorganized, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell striated muscle thin filament disorganized, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell Z disc disorganized, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac ventricle hypotrophic, abnormal WT + MO4-rbm24a Fig. S3 from Poon et al., 2012
cardiac ventricle non-contractile, abnormal sqet33mi3AEt + MO4-rbm24a text only from Poon et al., 2012
common cardinal vein decreased width, abnormal sd2Tg; y1Tg + MO4-rbm24a text only from Poon et al., 2012
heart morphology, abnormal WT + MO4-rbm24a Fig. 4,  Fig. S3 from Poon et al., 2012
heart contraction disrupted, abnormal sqet33mi3AEt + MO4-rbm24a text only from Poon et al., 2012
heart contraction process quality, abnormal WT + MO4-rbm24a Fig. 3 from Poon et al., 2012
pericardium edematous, abnormal WT + MO4-rbm24a Fig. S3 from Poon et al., 2012
sarcomere organization disrupted, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
whole organism viability, abnormal WT + MO4-rbm24a text only from Poon et al., 2012
yolk concave, abnormal sd2Tg; y1Tg + MO4-rbm24a Fig. 3,  Fig. S3 from Poon et al., 2012
Phenotype of all Fish created by or utilizing MO4-rbm24a
Phenotype Fish Conditions Figures
cardiac muscle cell decreased size, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
pericardium edematous, abnormal WT + MO4-rbm24a standard conditions Fig. S3 from Poon et al., 2012
cardiac muscle cell striated muscle myosin thick filament disorganized, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
cardiac muscle cell sarcomere increased length, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
yolk concave, abnormal WT + MO4-rbm24a standard conditions Fig. S3 from Poon et al., 2012
heart morphology, abnormal WT + MO4-rbm24a standard conditions Fig. 4,  Fig. S3 from Poon et al., 2012
blood circulation disrupted, abnormal WT + MO4-rbm24a standard conditions Fig. S3,  text only from Poon et al., 2012
heart contraction process quality, abnormal WT + MO4-rbm24a standard conditions Fig. 3 from Poon et al., 2012
atrium dilated, abnormal WT + MO4-rbm24a standard conditions Fig. S3 from Poon et al., 2012
cardiac muscle cell myofibril sparse, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
cardiac ventricle hypotrophic, abnormal WT + MO4-rbm24a standard conditions Fig. S3 from Poon et al., 2012
sarcomere organization disrupted, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
cardiac muscle cell striated muscle thin filament disorganized, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
whole organism viability, abnormal WT + MO4-rbm24a standard conditions text only from Poon et al., 2012
cardiac muscle cell Z disc disorganized, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
heart contraction disrupted, abnormal f2Tg + MO4-rbm24a standard conditions text only from Poon et al., 2012
heart contraction disrupted, abnormal sqet33mi3AEt + MO4-rbm24a standard conditions text only from Poon et al., 2012
cardiac ventricle non-contractile, abnormal sqet33mi3AEt + MO4-rbm24a standard conditions text only from Poon et al., 2012
blood circulation disrupted, abnormal sqet33mi3AEt + MO4-rbm24a standard conditions text only from Poon et al., 2012
common cardinal vein decreased width, abnormal sd2Tg; y1Tg + MO4-rbm24a standard conditions text only from Poon et al., 2012
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO4-rbm24a standard conditions Fig. 3,  text only from Poon et al., 2012
yolk concave, abnormal sd2Tg; y1Tg + MO4-rbm24a standard conditions Fig. 3 from Poon et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.