Morpholino

MO1-ift56

ID
ZDB-MRPHLNO-120906-3
Name
MO1-ift56
Previous Names
  • MO-AUG (1)
  • MO1-ttc26
Target
Sequence
5' - CTGGCTTCATCCGAGACAAGAGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift56
No data available
Phenotype
Phenotype resulting from MO1-ift56
Phenotype Fish Figures
cilium movement increased rate, abnormal AB + MO1-ift56 Fig. S2 from Zhang et al., 2012
heart looping process quality, abnormal f1Tg + MO1-ift56 Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium decreased amount, abnormal TL + MO1-ift56 Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-ift56 Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium movement decreased frequency, abnormal TL + MO1-ift56 Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium movement process quality, abnormal TL + MO1-ift56 Fig. 2 with image from Ishikawa et al., 2014
photoreceptor outer segment layer disorganized, abnormal AB + MO1-ift56 Fig. 3 from Zhang et al., 2012
photoreceptor outer segment layer shortened, abnormal AB + MO1-ift56 Fig. 3 from Zhang et al., 2012
post-vent region kinked, abnormal AB + MO1-ift56 Fig. 3 from Zhang et al., 2012
pronephric duct increased size, abnormal AB + MO1-ift56 Fig. 4 from Zhang et al., 2012
pronephric duct cilium decreased length, abnormal TL + MO1-ift56 Fig. 2 with image from Ishikawa et al., 2014
pronephric tubule dilated, abnormal AB + MO1-ift56 Fig. 4 from Zhang et al., 2012
pronephric tubule distended, abnormal AB + MO1-ift56 Fig. 4 from Zhang et al., 2012
pronephros cilium disorganized, abnormal AB + MO1-ift56 Fig. 4 from Zhang et al., 2012
pronephros cilium disoriented, abnormal AB + MO1-ift56 Fig. 4 from Zhang et al., 2012
pronephros cilium shortened, abnormal AB + MO1-ift56 Fig. 4 from Zhang et al., 2012
regulation of cilium beat frequency disrupted, abnormal AB + MO1-ift56 Fig. 5,  Fig. S2 from Zhang et al., 2012
whole organism curved, abnormal AB + MO1-ift56 Fig. 3 from Zhang et al., 2012
whole organism decreased length, abnormal AB + MO1-ift56 Fig. 3 from Zhang et al., 2012
Phenotype of all Fish created by or utilizing MO1-ift56
Phenotype Fish Conditions Figures
pronephric duct increased size, abnormal AB + MO1-ift56 standard conditions Fig. 4 from Zhang et al., 2012
pronephric tubule dilated, abnormal AB + MO1-ift56 standard conditions Fig. 4 from Zhang et al., 2012
whole organism decreased length, abnormal AB + MO1-ift56 standard conditions Fig. 3 from Zhang et al., 2012
pronephros cilium shortened, abnormal AB + MO1-ift56 standard conditions Fig. 4 from Zhang et al., 2012
cilium movement increased rate, abnormal AB + MO1-ift56 standard conditions Fig. S2 from Zhang et al., 2012
regulation of cilium beat frequency disrupted, abnormal AB + MO1-ift56 standard conditions Fig. 5,  Fig. S2 from Zhang et al., 2012
pronephros cilium disoriented, abnormal AB + MO1-ift56 standard conditions Fig. 4 from Zhang et al., 2012
whole organism curved, abnormal AB + MO1-ift56 standard conditions Fig. 3 from Zhang et al., 2012
photoreceptor outer segment layer disorganized, abnormal AB + MO1-ift56 standard conditions Fig. 3 from Zhang et al., 2012
post-vent region kinked, abnormal AB + MO1-ift56 standard conditions Fig. 3 from Zhang et al., 2012
pronephric tubule distended, abnormal AB + MO1-ift56 standard conditions Fig. 4 from Zhang et al., 2012
photoreceptor outer segment layer shortened, abnormal AB + MO1-ift56 standard conditions Fig. 3 from Zhang et al., 2012
pronephros cilium disorganized, abnormal AB + MO1-ift56 standard conditions Fig. 4 from Zhang et al., 2012
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-ift56 control Fig. 2 with image from Ishikawa et al., 2014
pronephric duct cilium decreased length, abnormal TL + MO1-ift56 control Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium movement decreased frequency, abnormal TL + MO1-ift56 control Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium decreased amount, abnormal TL + MO1-ift56 control Fig. 2 with image from Ishikawa et al., 2014
Kupffer's vesicle cilium movement process quality, abnormal TL + MO1-ift56 control Fig. 2 with image from Ishikawa et al., 2014
heart looping process quality, abnormal f1Tg + MO1-ift56 control Fig. 2 with image from Ishikawa et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.