Morpholino

MO1-exosc3

ID
ZDB-MRPHLNO-120611-1
Name
MO1-exosc3
Previous Names
None
Target
Sequence
5' - TCCATGATGGAGGAGCGGAAAACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-exosc3
Expressed Gene Anatomy Figures
atxn1a Fig. 11 from Francois-Moutal et al., 2018
Fig. 6 from Giunta et al., 2016
atxn1b Fig. 11 from Francois-Moutal et al., 2018
Fig. 6 from Giunta et al., 2016
Phenotype
Phenotype resulting from MO1-exosc3
Phenotype Fish Figures
axonogenesis disrupted, abnormal rw0Tg + MO1-exosc3 Fig. 5 with image from Giunta et al., 2016
brain decreased size, abnormal WT + MO1-exosc3 Fig. 3 from Wan et al., 2012
cerebellar Purkinje cell layer structural organization disrupted, abnormal rw0Tg + MO1-exosc3 Fig. 5 with image from Giunta et al., 2016
cerebellum structure, abnormal rw0Tg + MO1-exosc3 Fig. 5 with image from Giunta et al., 2016
cerebellum Purkinje cell distributed, abnormal rw0Tg + MO1-exosc3 Fig. 5 with image from Giunta et al., 2016
cranial nerve VII morphology, abnormal rw0Tg + MO1-exosc3 Fig. 4 with image from Giunta et al., 2016
hindbrain morphology, abnormal rw0Tg + MO1-exosc3 Fig. 4 with image from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal rw0Tg + MO1-exosc3 Fig. 4 with image from Giunta et al., 2016
locomotion decreased process quality, abnormal WT + MO1-exosc3 Fig. 3 from Wan et al., 2012
motor neuron axon branchiness, abnormal rw0Tg + MO1-exosc3 Fig. 5 with image from Giunta et al., 2016
motor neuron axon truncated, abnormal rw0Tg + MO1-exosc3 Fig. 5 with image from Giunta et al., 2016
spinal cord curved, abnormal WT + MO1-exosc3 Fig. 3 from Wan et al., 2012
vertebral column curved lateral, abnormal WT + MO1-exosc3 Fig. 8 from Francois-Moutal et al., 2018
vertebral column decreased length, abnormal WT + MO1-exosc3 Fig. 8 from Francois-Moutal et al., 2018
whole organism atxn1b expression increased amount, abnormal WT + MO1-exosc3 Fig. 11 from Francois-Moutal et al., 2018
whole organism movement quality, abnormal WT + MO1-exosc3 Fig. 3 from Wan et al., 2012
whole organism viability, abnormal WT + MO1-exosc3 Fig. 8 from Francois-Moutal et al., 2018
Phenotype of all Fish created by or utilizing MO1-exosc3
Phenotype Fish Conditions Figures
spinal cord curved, abnormal WT + MO1-exosc3 standard conditions Fig. 3 from Wan et al., 2012
whole organism viability, abnormal WT + MO1-exosc3 standard conditions Fig. 8 from Francois-Moutal et al., 2018
brain decreased size, abnormal WT + MO1-exosc3 standard conditions Fig. 3 from Wan et al., 2012
vertebral column decreased length, abnormal WT + MO1-exosc3 standard conditions Fig. 8 from Francois-Moutal et al., 2018
whole organism movement quality, abnormal WT + MO1-exosc3 standard conditions Fig. 3 from Wan et al., 2012
vertebral column curved lateral, abnormal WT + MO1-exosc3 standard conditions Fig. 8 from Francois-Moutal et al., 2018
locomotion decreased process quality, abnormal WT + MO1-exosc3 standard conditions Fig. 3 from Wan et al., 2012
whole organism atxn1b expression increased amount, abnormal WT + MO1-exosc3 standard conditions Fig. 11 from Francois-Moutal et al., 2018
axonogenesis disrupted, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 5 with image from Giunta et al., 2016
cranial nerve VII morphology, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 4 with image from Giunta et al., 2016
motor neuron axon truncated, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 5 with image from Giunta et al., 2016
motor neuron axon branchiness, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 5 with image from Giunta et al., 2016
cerebellum structure, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 5 with image from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 4 with image from Giunta et al., 2016
hindbrain morphology, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 4 with image from Giunta et al., 2016
cerebellum Purkinje cell distributed, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 5 with image from Giunta et al., 2016
cerebellar Purkinje cell layer structural organization disrupted, abnormal rw0Tg + MO1-exosc3 standard conditions Fig. 5 with image from Giunta et al., 2016
whole organism atxn1b expression increased amount, abnormal slc24a5unspecified/unspecified + MO1-exosc3 standard conditions Fig. 6 from Giunta et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.