Morpholino

MO1-kctd13

ID
ZDB-MRPHLNO-120529-5
Name
MO1-kctd13
Previous Names
None
Target
Sequence
5' - TCTAAGGGTACACGCCTGACCTGTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kctd13
No data available
Phenotype
Phenotype resulting from MO1-kctd13
Phenotype Fish Figures
brain neuron increased amount, abnormal WT + MO1-kctd13 Fig. 3 from Golzio et al., 2012
cell proliferation in forebrain increased occurrence, abnormal WT + MO1-kctd13 Fig. 2 from Golzio et al., 2012
cell proliferation in hindbrain increased occurrence, abnormal WT + MO1-kctd13 Fig. 2 from Golzio et al., 2012
cell proliferation in midbrain increased occurrence, abnormal WT + MO1-kctd13 Fig. 2 from Golzio et al., 2012
diencephalon hypoplastic, abnormal WT + MO1-kctd13 Fig. 3 from Golzio et al., 2012
eye increased distance eye, abnormal WT + MO1-kctd13 Fig. 3 from Migliavacca et al., 2015
forebrain asymmetrical, abnormal WT + MO1-kctd13 Fig. 3 from Golzio et al., 2012
forebrain neuron increased amount, abnormal WT + MO1-kctd13 Fig. 3 from Migliavacca et al., 2015
head increased size, abnormal WT + MO1-kctd13 Fig. 3 from Migliavacca et al., 2015
Fig. 2 from Golzio et al., 2012
midbrain hypoplastic, abnormal WT + MO1-kctd13 Fig. 3 from Golzio et al., 2012
telencephalon hypoplastic, abnormal WT + MO1-kctd13 Fig. 3,  Fig. S4 from Golzio et al., 2012
white matter spatial pattern, abnormal WT + MO1-kctd13 Fig. 3 from Golzio et al., 2012
Phenotype of all Fish created by or utilizing MO1-kctd13
Phenotype Fish Conditions Figures
brain neuron increased amount, abnormal WT + MO1-kctd13 standard conditions Fig. 3 from Golzio et al., 2012
forebrain asymmetrical, abnormal WT + MO1-kctd13 standard conditions Fig. 3 from Golzio et al., 2012
forebrain neuron increased amount, abnormal WT + MO1-kctd13 standard conditions Fig. 3 from Migliavacca et al., 2015
eye increased distance eye, abnormal WT + MO1-kctd13 standard conditions Fig. 3 from Migliavacca et al., 2015
head increased size, abnormal WT + MO1-kctd13 standard conditions Fig. 3 from Migliavacca et al., 2015
Fig. 2 from Golzio et al., 2012
cell proliferation in hindbrain increased occurrence, abnormal WT + MO1-kctd13 standard conditions Fig. 2 from Golzio et al., 2012
white matter spatial pattern, abnormal WT + MO1-kctd13 standard conditions Fig. 3 from Golzio et al., 2012
telencephalon hypoplastic, abnormal WT + MO1-kctd13 standard conditions Fig. 3,  Fig. S4 from Golzio et al., 2012
cell proliferation in forebrain increased occurrence, abnormal WT + MO1-kctd13 standard conditions Fig. 2 from Golzio et al., 2012
diencephalon hypoplastic, abnormal WT + MO1-kctd13 standard conditions Fig. 3 from Golzio et al., 2012
cell proliferation in midbrain increased occurrence, abnormal WT + MO1-kctd13 standard conditions Fig. 2 from Golzio et al., 2012
midbrain hypoplastic, abnormal WT + MO1-kctd13 standard conditions Fig. 3 from Golzio et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.