Morpholino

MO1-cacnb2a

ID
ZDB-MRPHLNO-120511-10
Name
MO1-cacnb2a
Previous Names
None
Target
Sequence
5' - ATGCAACAGACACCTTGAGTAAAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO. The author was contacted and provided the correct sequence.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cacnb2a
Expressed Gene Anatomy Figures
bmp4 Fig. 6 with image from Chernyavskaya et al., 2012
cacnb2a Fig. 1 with image from Chernyavskaya et al., 2012
cacnb2b Fig. 1 with image from Chernyavskaya et al., 2012
cdh2 Fig. 10 with image from Chernyavskaya et al., 2012
fgf8a Fig. 6 with image from Chernyavskaya et al., 2012
myh7 Fig. 6 with image from Chernyavskaya et al., 2012
myl7 Fig. 2 with image from Chernyavskaya et al., 2012
Phenotype
Phenotype resulting from MO1-cacnb2a
Phenotype Fish Figures
blood circulation decreased process quality, abnormal WT + MO1-cacnb2a Fig. 5 with image from Chernyavskaya et al., 2012
cardiac ventricle decreased volume, abnormal WT + MO1-cacnb2a Fig. 5 with image from Chernyavskaya et al., 2012
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal WT + MO1-cacnb2a Fig. 7 from Chernyavskaya et al., 2012
cardiac ventricle cardiac muscle cell circular, abnormal s883Tg + MO1-cacnb2a Fig. 4 with image from Chernyavskaya et al., 2012
cardiac ventricle cardiac muscle cell decreased area, abnormal s883Tg + MO1-cacnb2a Fig. 4 with image from Chernyavskaya et al., 2012
cardiac ventricle sarcomere organization decreased process quality, abnormal s883Tg + MO1-cacnb2a Fig. 10 with image from Chernyavskaya et al., 2012
cell adhesion involved in heart morphogenesis decreased process quality, abnormal f2Tg + MO1-cacnb2a Fig. 9 with image from Chernyavskaya et al., 2012
cell proliferation involved in heart morphogenesis decreased occurrence, abnormal WT + MO1-cacnb2a Fig. 8 with image from Chernyavskaya et al., 2012
cell-cell adhesion mediated by cadherin decreased process quality, abnormal s883Tg + MO1-cacnb2a Fig. 10 with image from Chernyavskaya et al., 2012
heart decreased contractility, abnormal WT + MO1-cacnb2a Fig. 2 with image from Chernyavskaya et al., 2012
heart edematous, abnormal WT + MO1-cacnb2a Fig. 2 with image from Chernyavskaya et al., 2012
heart malformed, abnormal WT + MO1-cacnb2a Fig. 2 with image,  Fig. 3 with image from Chernyavskaya et al., 2012
heart contraction decreased process quality, abnormal WT + MO1-cacnb2a Fig. 2 with image from Chernyavskaya et al., 2012
heart contraction decreased rate, abnormal WT + MO1-cacnb2a Fig. 5 with image from Chernyavskaya et al., 2012
heart looping decreased process quality, abnormal s883Tg + MO1-cacnb2a Fig. 2 with image,  Fig. 3 with image from Chernyavskaya et al., 2012
heart tube increased fragility, abnormal f2Tg + MO1-cacnb2a Fig. 9 with image from Chernyavskaya et al., 2012
Phenotype of all Fish created by or utilizing MO1-cacnb2a
Phenotype Fish Conditions Figures
heart malformed, abnormal WT + MO1-cacnb2a standard conditions Fig. 2 with image from Chernyavskaya et al., 2012
heart contraction decreased process quality, abnormal WT + MO1-cacnb2a standard conditions Fig. 2 with image from Chernyavskaya et al., 2012
cell proliferation involved in heart morphogenesis decreased occurrence, abnormal WT + MO1-cacnb2a standard conditions Fig. 8 with image from Chernyavskaya et al., 2012
heart edematous, abnormal WT + MO1-cacnb2a standard conditions Fig. 2 with image from Chernyavskaya et al., 2012
heart looping decreased process quality, abnormal WT + MO1-cacnb2a standard conditions Fig. 2 with image from Chernyavskaya et al., 2012
cardiac ventricle decreased volume, abnormal WT + MO1-cacnb2a standard conditions Fig. 5 with image from Chernyavskaya et al., 2012
heart decreased contractility, abnormal WT + MO1-cacnb2a standard conditions Fig. 2 with image from Chernyavskaya et al., 2012
blood circulation decreased process quality, abnormal WT + MO1-cacnb2a standard conditions Fig. 5 with image from Chernyavskaya et al., 2012
heart contraction decreased rate, abnormal WT + MO1-cacnb2a standard conditions Fig. 5 with image from Chernyavskaya et al., 2012
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal WT + MO1-cacnb2a standard conditions Fig. 7 from Chernyavskaya et al., 2012
cell adhesion involved in heart morphogenesis decreased process quality, abnormal f2Tg + MO1-cacnb2a standard conditions Fig. 9 with image from Chernyavskaya et al., 2012
heart tube increased fragility, abnormal f2Tg + MO1-cacnb2a standard conditions Fig. 9 with image from Chernyavskaya et al., 2012
cardiac ventricle cardiac muscle cell decreased area, abnormal s883Tg + MO1-cacnb2a standard conditions Fig. 4 with image from Chernyavskaya et al., 2012
cardiac ventricle sarcomere organization decreased process quality, abnormal s883Tg + MO1-cacnb2a standard conditions Fig. 10 with image from Chernyavskaya et al., 2012
heart malformed, abnormal s883Tg + MO1-cacnb2a standard conditions Fig. 3 with image from Chernyavskaya et al., 2012
heart looping decreased process quality, abnormal s883Tg + MO1-cacnb2a standard conditions Fig. 3 with image from Chernyavskaya et al., 2012
cardiac ventricle cardiac muscle cell circular, abnormal s883Tg + MO1-cacnb2a standard conditions Fig. 4 with image from Chernyavskaya et al., 2012
cell-cell adhesion mediated by cadherin decreased process quality, abnormal s883Tg + MO1-cacnb2a standard conditions Fig. 10 with image from Chernyavskaya et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.