Morpholino

MO1-oip5-as1

ID
ZDB-MRPHLNO-120209-1
Name
MO1-oip5-as1
Previous Names
  • cyrano e1i1 MO (1)
  • MO1-si:dkey-71p21.9
Target
Sequence
5' - AACACTCATCCCGCACTTACCGTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-oip5-as1
No data available
Phenotype
Phenotype resulting from MO1-oip5-as1
Phenotype Fish Figures
brain development disrupted, abnormal WT + MO1-oip5-as1 Fig. 5 with image from Ulitsky et al., 2011
eye decreased size, abnormal AB/TL + MO1-oip5-as1 Fig. 2 with image from Goudarzi et al., 2019
Fig. 5 with image from Ulitsky et al., 2011
head decreased size, abnormal AB/TL + MO1-oip5-as1 Fig. 2 with image from Goudarzi et al., 2019
Fig. 5 with image from Ulitsky et al., 2011
heart edematous, abnormal oip5-as1a171/a171 + MO1-oip5-as1 (AB/TL) Fig. 2 with image from Goudarzi et al., 2019
optic tectum EGFP expression decreased distribution, abnormal nl1Tg + MO1-oip5-as1 Fig. S4 with image from Ulitsky et al., 2011
peripheral olfactory organ EGFP expression increased distribution, abnormal nl1Tg + MO1-oip5-as1 Fig. 5 with image from Ulitsky et al., 2011
peripheral olfactory organ increased size, abnormal nl1Tg + MO1-oip5-as1 Fig. 5 with image from Ulitsky et al., 2011
post-vent region decreased length, abnormal WT + MO1-oip5-as1 Fig. 5 with image from Ulitsky et al., 2011
post-vent region increased curvature, abnormal WT + MO1-oip5-as1 Fig. 5 with image from Ulitsky et al., 2011
post-vent region kinked, abnormal AB/TL + MO1-oip5-as1 Fig. 2 with image from Goudarzi et al., 2019
retina EGFP expression decreased distribution, abnormal nl1Tg + MO1-oip5-as1 Fig. 5 with image,  Fig. S4 with image from Ulitsky et al., 2011
Phenotype of all Fish created by or utilizing MO1-oip5-as1
Phenotype Fish Conditions Figures
heart edematous, abnormal oip5-as1a171/a171 + MO1-oip5-as1 (AB/TL) standard conditions Fig. 2 with image from Goudarzi et al., 2019
head decreased size, abnormal oip5-as1a171/a171 + MO1-oip5-as1 (AB/TL) standard conditions Fig. 2 with image from Goudarzi et al., 2019
eye decreased size, abnormal oip5-as1a171/a171 + MO1-oip5-as1 (AB/TL) standard conditions Fig. 2 with image from Goudarzi et al., 2019
post-vent region kinked, abnormal oip5-as1a171/a171 + MO1-oip5-as1 (AB/TL) standard conditions Fig. 2 with image from Goudarzi et al., 2019
heart edematous, abnormal AB/TL + MO1-oip5-as1 standard conditions Fig. 2 with image from Goudarzi et al., 2019
head decreased size, abnormal AB/TL + MO1-oip5-as1 standard conditions Fig. 2 with image from Goudarzi et al., 2019
eye decreased size, abnormal AB/TL + MO1-oip5-as1 standard conditions Fig. 2 with image from Goudarzi et al., 2019
post-vent region kinked, abnormal AB/TL + MO1-oip5-as1 standard conditions Fig. 2 with image from Goudarzi et al., 2019
brain development disrupted, abnormal WT + MO1-oip5-as1 standard conditions Fig. 5 with image from Ulitsky et al., 2011
post-vent region increased curvature, abnormal WT + MO1-oip5-as1 standard conditions Fig. 5 with image from Ulitsky et al., 2011
eye decreased size, abnormal WT + MO1-oip5-as1 standard conditions Fig. 5 with image from Ulitsky et al., 2011
post-vent region decreased length, abnormal WT + MO1-oip5-as1 standard conditions Fig. 5 with image from Ulitsky et al., 2011
head decreased size, abnormal WT + MO1-oip5-as1 standard conditions Fig. 5 with image from Ulitsky et al., 2011
optic tectum EGFP expression decreased distribution, abnormal nl1Tg + MO1-oip5-as1 standard conditions Fig. S4 with image from Ulitsky et al., 2011
retina EGFP expression decreased distribution, abnormal nl1Tg + MO1-oip5-as1 standard conditions Fig. 5 with image,  Fig. S4 with image from Ulitsky et al., 2011
peripheral olfactory organ increased size, abnormal nl1Tg + MO1-oip5-as1 standard conditions Fig. 5 with image from Ulitsky et al., 2011
peripheral olfactory organ EGFP expression increased distribution, abnormal nl1Tg + MO1-oip5-as1 standard conditions Fig. 5 with image from Ulitsky et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.