Morpholino

MO1-enpp2

ID

ZDB-MRPHLNO-120123-5

Name

MO1-enpp2

Previous Names

ATX MO1 (1)

Target

enpp2 (1)

Sequence

5' - GGAGAATACCTGGGTCGAGACACCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-enpp2

Expressed Gene	Anatomy	Figures
enpp2	(not) whole organism	Fig. 5 from Yukiura et al., 2011

Phenotype

Phenotype resulting from MO1-enpp2

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	y1Tg + MO1-enpp2 (AB)	Fig. 5 from Yukiura et al., 2011
cartilage development process quality, abnormal	AB + MO1-enpp2	Fig. 1 from Nishioka et al., 2016
ceratohyal cartilage deformed, abnormal	AB + MO1-enpp2	Fig. 1 from Nishioka et al., 2016
ceratohyal cartilage chondrocyte disorganized, abnormal	zf678Tg + MO1-enpp2	Fig. 1 from Nishioka et al., 2016
ceratohyal cartilage chondrocyte increased variability of size, abnormal	zf678Tg + MO1-enpp2	Fig. 1 from Nishioka et al., 2016
cranium malformed, abnormal	AB + MO1-enpp2	Fig. 1 , Fig. S1 from Nishioka et al., 2016
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO1-enpp2 (AB)	Fig. 5 from Yukiura et al., 2011
head circular, abnormal	AB + MO1-enpp2	Fig. 1 from Nishioka et al., 2016
head edematous, abnormal	AB + MO1-enpp2	Fig. 5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental vessel, abnormal	y1Tg + MO1-enpp2 (AB)	Fig. 5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental artery, abnormal	y1Tg + MO1-enpp2 (AB)	Fig. 5 from Yukiura et al., 2011
intersegmental artery decreased length, abnormal	y1Tg + MO1-enpp2 (AB)	Fig. 5 from Yukiura et al., 2011
Meckel's cartilage deformed, abnormal	AB + MO1-enpp2	Fig. 1 from Nishioka et al., 2016
Meckel's cartilage chondrocyte disorganized, abnormal	zf678Tg + MO1-enpp2	Fig. 1 from Nishioka et al., 2016
Meckel's cartilage chondrocyte increased variability of size, abnormal	zf678Tg + MO1-enpp2	Fig. 1 from Nishioka et al., 2016
pericardium edematous, abnormal	AB + MO1-enpp2	Fig. 5 from Yukiura et al., 2011

Phenotype of all Fish created by or utilizing MO1-enpp2

Phenotype	Fish	Conditions	Figures
head edematous, abnormal	AB + MO1-enpp2	standard conditions	Fig. 5 from Yukiura et al., 2011
cranium malformed, abnormal	AB + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016
pericardium edematous, abnormal	AB + MO1-enpp2	standard conditions	Fig. 5 from Yukiura et al., 2011
cartilage development process quality, abnormal	AB + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016
Meckel's cartilage deformed, abnormal	AB + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016
head circular, abnormal	AB + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016
ceratohyal cartilage deformed, abnormal	AB + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016
intersegmental artery decreased length, abnormal	y1Tg + MO1-enpp2 (AB)	standard conditions	Fig. 5 from Yukiura et al., 2011
angiogenesis disrupted, abnormal	y1Tg + MO1-enpp2 (AB)	standard conditions	Fig. 5 from Yukiura et al., 2011
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO1-enpp2 (AB)	standard conditions	Fig. 5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental artery, abnormal	y1Tg + MO1-enpp2 (AB)	standard conditions	Fig. 5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental vessel, abnormal	y1Tg + MO1-enpp2 (AB)	standard conditions	Fig. 5 from Yukiura et al., 2011
Meckel's cartilage chondrocyte disorganized, abnormal	zf678Tg + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016
ceratohyal cartilage chondrocyte increased variability of size, abnormal	zf678Tg + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016
cranium malformed, abnormal	zf678Tg + MO1-enpp2	standard conditions	Fig. S1 from Nishioka et al., 2016
ceratohyal cartilage chondrocyte disorganized, abnormal	zf678Tg + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016
Meckel's cartilage chondrocyte increased variability of size, abnormal	zf678Tg + MO1-enpp2	standard conditions	Fig. 1 from Nishioka et al., 2016

Citations