Morpholino

MO2-fktn

ID

ZDB-MRPHLNO-120113-1

Name

MO2-fktn

Previous Names

None

Target

fktn (1)

Sequence

5' - GCCCAGAAACCTCTTCAGCAGATGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-fktn

No data available

Phenotype

Phenotype resulting from MO2-fktn

Phenotype	Fish	Figures
dorsal aorta intersegmental vessel separated from dorsal longitudinal anastomotic vessel, abnormal	y1Tg + MO2-fktn	Fig. 5 from Wood et al., 2011
embryo development delayed, abnormal	y1Tg + MO2-fktn	Fig. 2 from Wood et al., 2011
inner optic circle blood vessel decreased size, abnormal	y1Tg + MO2-fktn	Fig. 6 from Wood et al., 2011
inner optic circle blood vessel elliptic, abnormal	y1Tg + MO2-fktn	Fig. 6 from Wood et al., 2011
larval locomotory behavior disrupted, abnormal	y1Tg + MO2-fktn	Fig. 2 from Wood et al., 2011
ocular blood vessel decreased size, abnormal	y1Tg + MO2-fktn	Fig. 7 from Wood et al., 2011
ocular blood vessel deformed, abnormal	y1Tg + MO2-fktn	Fig. 6 from Wood et al., 2011
post-vent region curved ventral, abnormal	y1Tg + MO2-fktn	Fig. 2 from Wood et al., 2011
post-vent region decreased length, abnormal	y1Tg + MO2-fktn	Fig. 2 from Wood et al., 2011
somite circular, abnormal	y1Tg + MO2-fktn	Fig. 2 from Wood et al., 2011
somite intersegmental vessel absent, abnormal	y1Tg + MO2-fktn	Fig. 5 from Wood et al., 2011
somite intersegmental vessel disorganized, abnormal	y1Tg + MO2-fktn	Fig. 5 from Wood et al., 2011
somite myofibril unstructured, abnormal	y1Tg + MO2-fktn	Fig. 3 from Wood et al., 2011
somite myoseptum deformed, abnormal	y1Tg + MO2-fktn	Fig. 4 from Wood et al., 2011
whole organism dead, abnormal	y1Tg + MO2-fktn	Fig. 2 from Wood et al., 2011

Phenotype of all Fish created by or utilizing MO2-fktn

Phenotype	Fish	Conditions	Figures
somite intersegmental vessel disorganized, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 5 from Wood et al., 2011
dorsal aorta intersegmental vessel separated from dorsal longitudinal anastomotic vessel, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 5 from Wood et al., 2011
whole organism dead, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 2 from Wood et al., 2011
inner optic circle blood vessel decreased size, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 6 from Wood et al., 2011
inner optic circle blood vessel elliptic, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 6 from Wood et al., 2011
somite circular, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 2 from Wood et al., 2011
somite myoseptum deformed, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 4 from Wood et al., 2011
ocular blood vessel deformed, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 6 from Wood et al., 2011
larval locomotory behavior disrupted, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 2 from Wood et al., 2011
ocular blood vessel decreased size, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 7 from Wood et al., 2011
embryo development delayed, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 2 from Wood et al., 2011
somite myofibril unstructured, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 3 from Wood et al., 2011
post-vent region curved ventral, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 2 from Wood et al., 2011
somite intersegmental vessel absent, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 5 from Wood et al., 2011
post-vent region decreased length, abnormal	y1Tg + MO2-fktn	standard conditions	Fig. 2 from Wood et al., 2011

Citations