Morpholino

MO1-ush1c

ID

ZDB-MRPHLNO-111222-1

Name

MO1-ush1c

Previous Names

None

Target

ush1c (1)

Sequence

5' - TAGAATTGAGACTTACTGATGGTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ush1c

Expressed Gene	Anatomy	Figures
ush1c	hair cell anterior macula kinocilium Muller cell otic sensory epithelium	Fig. 3 , Fig. 4 , Fig. 5 from Phillips et al., 2011

Phenotype

Phenotype resulting from MO1-ush1c

Phenotype	Fish	Figures
auditory receptor cell kinocilium absent, abnormal	ush1c^fh293/fh293 + MO1-ush1c	Fig. 4 from Phillips et al., 2011
auditory receptor cell kinocilium bent, abnormal	WT + MO1-ush1c	Fig. 3 from Phillips et al., 2011
auditory receptor cell stereocilium bundle splayed, abnormal	WT + MO1-ush1c	Fig. 3 from Phillips et al., 2011
detection of light stimulus involved in visual perception disrupted, abnormal	AB + MO1-ush1c	text only from Phillips et al., 2011
hair cell anterior macula decreased amount, abnormal	WT + MO1-ush1c	Fig. 3 from Phillips et al., 2011
hair cell posterior macula decreased amount, abnormal	WT + MO1-ush1c	Fig. 3 from Phillips et al., 2011
optomotor response disrupted, abnormal	WT + MO1-ush1c	Fig. 2 from Phillips et al., 2011
postsynaptic density assembly disrupted, abnormal	AB + MO1-ush1c	Fig. 7 from Phillips et al., 2011
retinal cone cell cytoskeleton of presynaptic active zone detached from retinal outer plexiform layer postsynaptic density, abnormal	AB + MO1-ush1c	Fig. 7 from Phillips et al., 2011
retinal outer plexiform layer synapse disorganized, abnormal	AB + MO1-ush1c	Fig. 7 from Phillips et al., 2011
startle response disrupted, abnormal	WT + MO1-ush1c	Fig. 2 from Phillips et al., 2011
synapse assembly disrupted, abnormal	AB + MO1-ush1c	Fig. 7 from Phillips et al., 2011

Phenotype of all Fish created by or utilizing MO1-ush1c

Phenotype	Fish	Conditions	Figures
auditory receptor cell kinocilium absent, abnormal	ush1c^fh293/fh293 + MO1-ush1c	standard conditions	Fig. 4 from Phillips et al., 2011
postsynaptic density assembly disrupted, abnormal	AB + MO1-ush1c	standard conditions	Fig. 7 from Phillips et al., 2011
detection of light stimulus involved in visual perception disrupted, abnormal	AB + MO1-ush1c	standard conditions	text only from Phillips et al., 2011
retinal outer plexiform layer synapse disorganized, abnormal	AB + MO1-ush1c	standard conditions	Fig. 7 from Phillips et al., 2011
retinal cone cell cytoskeleton of presynaptic active zone detached from retinal outer plexiform layer postsynaptic density, abnormal	AB + MO1-ush1c	standard conditions	Fig. 7 from Phillips et al., 2011
synapse assembly disrupted, abnormal	AB + MO1-ush1c	standard conditions	Fig. 7 from Phillips et al., 2011
auditory receptor cell kinocilium bent, abnormal	WT + MO1-ush1c	standard conditions	Fig. 3 from Phillips et al., 2011
hair cell anterior macula decreased amount, abnormal	WT + MO1-ush1c	standard conditions	Fig. 3 from Phillips et al., 2011
hair cell posterior macula decreased amount, abnormal	WT + MO1-ush1c	standard conditions	Fig. 3 from Phillips et al., 2011
startle response disrupted, abnormal	WT + MO1-ush1c	standard conditions	Fig. 2 from Phillips et al., 2011
optomotor response disrupted, abnormal	WT + MO1-ush1c	standard conditions	Fig. 2 from Phillips et al., 2011
auditory receptor cell stereocilium bundle splayed, abnormal	WT + MO1-ush1c	standard conditions	Fig. 3 from Phillips et al., 2011

Citations