Morpholino

MO2-vgll2a

ID
ZDB-MRPHLNO-110919-1
Name
MO2-vgll2a
Previous Names
  • vgll2a ATG MO (1)
Target
Sequence
5' - CATCCAAGCAGCTCATGGCGAAGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vgll2a
Expressed Gene Anatomy Figures
barx1 Fig. 4 with image from Johnson et al., 2011
dlx2a Fig. 4 with image from Johnson et al., 2011
Phenotype
Phenotype resulting from MO2-vgll2a
Phenotype Fish Figures
cell death increased occurrence, abnormal WT + MO2-vgll2a Fig. 5 with image from Johnson et al., 2011
ceratohyal cartilage hypoplastic, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
cranial neural crest cell decreased amount, abnormal WT + MO2-vgll2a text only from Johnson et al., 2011
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
ethmoid cartilage decreased size, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
hyosymplectic cartilage hypoplastic, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
Meckel's cartilage hypoplastic, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
palatoquadrate cartilage hypoplastic, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch morphology, abnormal WT + MO2-vgll2a Fig. 5 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 5 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 2 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 1 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 4 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 3 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal epithelium disorganized, abnormal WT + MO2-vgll2a Fig. 3 with image from Johnson et al., 2011
pharyngeal pouch decreased length, abnormal WT + MO2-vgll2a Fig. 3 with image from Johnson et al., 2011
pharyngeal pouch increased width, abnormal WT + MO2-vgll2a Fig. 3 with image from Johnson et al., 2011
Phenotype of all Fish created by or utilizing MO2-vgll2a
Phenotype Fish Conditions Figures
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal epithelium disorganized, abnormal WT + MO2-vgll2a standard conditions Fig. 3 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 5 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
ethmoid cartilage decreased size, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
ceratohyal cartilage hypoplastic, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 1 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal arch morphology, abnormal WT + MO2-vgll2a standard conditions Fig. 5 with image from Johnson et al., 2011
Meckel's cartilage hypoplastic, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 4 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
hyosymplectic cartilage hypoplastic, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 3 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
cell death increased occurrence, abnormal WT + MO2-vgll2a standard conditions Fig. 5 with image from Johnson et al., 2011
pharyngeal pouch increased width, abnormal WT + MO2-vgll2a standard conditions Fig. 3 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 2 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
palatoquadrate cartilage hypoplastic, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal pouch decreased length, abnormal WT + MO2-vgll2a standard conditions Fig. 3 with image from Johnson et al., 2011
cranial neural crest cell decreased amount, abnormal WT + MO2-vgll2a standard conditions text only from Johnson et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.