Morpholino

MO2-esr2a

ID
ZDB-MRPHLNO-110822-1
Name
MO2-esr2a
Previous Names
None
Target
Sequence
5' - TGTCTCCTTCGGGATACTCGGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-esr2a
No data available
Phenotype
Phenotype resulting from MO2-esr2a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
brain apoptotic, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
brain decreased size, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
brain development process quality, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
caudal fin hypoplastic, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
ceratobranchial cartilage decreased length, abnormal WT + MO2-esr2a Fig. 5 from Celeghin et al., 2011
ceratohyal cartilage orientation basibranchial, abnormal WT + MO2-esr2a Fig. 5 from Celeghin et al., 2011
developmental growth delayed, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
epithelium ventral region hypertrophic, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
extension decreased size, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
extension edematous, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
eye decreased size, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
Meckel's cartilage stubby, abnormal WT + MO2-esr2a Fig. 5 from Celeghin et al., 2011
otic vesicle decreased size, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
palatoquadrate cartilage bent, abnormal WT + MO2-esr2a Fig. 5 from Celeghin et al., 2011
pericardium edematous, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
splanchnocranium morphology, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
subintestinal vein aplastic, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
subintestinal vein hypoplastic, abnormal y1Tg + MO2-esr2a Fig. 4 from Celeghin et al., 2011
swim bladder inflation arrested, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
thigmotaxis disrupted, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
trunk curved, abnormal WT + MO2-esr2a + MO4-tp53 Fig. 3 from Celeghin et al., 2011
whole organism apoptotic, abnormal WT + MO2-esr2a Fig. 4 from Celeghin et al., 2011
whole organism circling, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
whole organism decreased size, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
whole organism viability, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
yolk increased volume, abnormal WT + MO2-esr2a Fig. 3 from Celeghin et al., 2011
Phenotype of all Fish created by or utilizing MO2-esr2a
Phenotype Fish Conditions Figures
extension edematous, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
splanchnocranium morphology, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
extension decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
whole organism decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
Meckel's cartilage stubby, abnormal WT + MO2-esr2a standard conditions Fig. 5 from Celeghin et al., 2011
apoptotic process increased occurrence, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
trunk curved, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
developmental growth delayed, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
pericardium edematous, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
whole organism apoptotic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
whole organism viability, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
epithelium ventral region hypertrophic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
subintestinal vein hypoplastic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
eye decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
palatoquadrate cartilage bent, abnormal WT + MO2-esr2a standard conditions Fig. 5 from Celeghin et al., 2011
caudal fin hypoplastic, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
subintestinal vein aplastic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
brain apoptotic, abnormal WT + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
brain development process quality, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
swim bladder inflation arrested, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
otic vesicle decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
brain decreased size, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
ceratohyal cartilage orientation basibranchial, abnormal WT + MO2-esr2a standard conditions Fig. 5 from Celeghin et al., 2011
thigmotaxis disrupted, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
ceratobranchial cartilage decreased length, abnormal WT + MO2-esr2a standard conditions Fig. 5 from Celeghin et al., 2011
yolk increased volume, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
whole organism circling, abnormal WT + MO2-esr2a standard conditions Fig. 3 from Celeghin et al., 2011
whole organism circling, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
thigmotaxis disrupted, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
brain decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
extension decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
trunk curved, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
splanchnocranium morphology, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
caudal fin hypoplastic, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
developmental growth delayed, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
yolk increased volume, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
whole organism decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
pericardium edematous, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
otic vesicle decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
swim bladder inflation arrested, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
extension edematous, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
eye decreased size, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
brain development process quality, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
whole organism viability, abnormal WT + MO2-esr2a + MO4-tp53 standard conditions Fig. 3 from Celeghin et al., 2011
subintestinal vein aplastic, abnormal y1Tg + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
subintestinal vein hypoplastic, abnormal y1Tg + MO2-esr2a standard conditions Fig. 4 from Celeghin et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.