Morpholino

MO2-ltbp3

ID
ZDB-MRPHLNO-110801-4
Name
MO2-ltbp3
Previous Names
  • MOspl (1)
Target
Sequence
5' - ACCACCTGGACAGATACATTTATTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to second-intron splice acceptor sequence
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ltbp3
Expressed Gene Anatomy Figures
elnb Fig. 2 from Zhou et al., 2011
mir145 Fig. 6 with image from Gays et al., 2017
Phenotype
Phenotype resulting from MO2-ltbp3
Phenotype Fish Figures
bulbus arteriosus lacks all parts of type smooth muscle myoblast, abnormal WT + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
cardiac ventricle has fewer parts of type ventricular endocardium, abnormal y7Tg + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
cardiac ventricle physical object quality, abnormal fb1Tg; fb2Tg + MO2-ltbp3 Fig. 3 from Zhou et al., 2011
cardiac ventricle morphogenesis decreased process quality, abnormal fb1Tg; fb2Tg + MO2-ltbp3 Fig. 3 from Zhou et al., 2011
heart looping decreased process quality, abnormal WT + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
intestine smooth muscle ab1-tagln labeling decreased amount, abnormal uto5Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
intestine smooth muscle mCherry expression decreased amount, abnormal uto5Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
intestine smooth muscle cell decreased amount, abnormal s854Tg; uto5Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
lateral plate mesoderm tissue migration decreased occurrence, abnormal pd24Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
lateral plate mesoderm tissue migration decreased process quality, abnormal pd24Tg + MO2-ltbp3 Fig. 3 with image from Gays et al., 2017
outflow tract morphogenesis decreased process quality, abnormal WT + MO2-ltbp3 Fig. 3Fig. 4 from Zhou et al., 2011
pharyngeal vasculature hypoplastic, abnormal s843Tg + MO2-ltbp3 Fig. S6 from Zhou et al., 2011
pharyngeal vasculature malformed, abnormal s843Tg + MO2-ltbp3 Fig. S6 from Zhou et al., 2011
presumptive bulbus arteriosus hypoplastic, abnormal WT + MO2-ltbp3 Fig. 3Fig. 4 from Zhou et al., 2011
presumptive cardiac ventricle heart tube decreased length, abnormal WT + MO2-ltbp3 Fig. 2 from Zhou et al., 2011
transforming growth factor beta receptor signaling pathway decreased process quality, abnormal WT + MO2-ltbp3 Fig. 4 from Zhou et al., 2011
whole organism mir145 expression decreased amount, abnormal WT + MO2-ltbp3 Fig. 6 with image from Gays et al., 2017
whole organism lacks all parts of type ventral aorta, abnormal WT + MO2-ltbp3 text only from Zhou et al., 2011
Phenotype of all Fish created by or utilizing MO2-ltbp3
Phenotype Fish Conditions Figures
transforming growth factor beta receptor signaling pathway decreased process quality, abnormal WT + MO2-ltbp3 standard conditions Fig. 4 from Zhou et al., 2011
presumptive bulbus arteriosus hypoplastic, abnormal WT + MO2-ltbp3 standard conditions Fig. 4 from Zhou et al., 2011
whole organism lacks all parts of type ventral aorta, abnormal WT + MO2-ltbp3 standard conditions text only from Zhou et al., 2011
outflow tract morphogenesis decreased process quality, abnormal WT + MO2-ltbp3 standard conditions Fig. 4 from Zhou et al., 2011
presumptive cardiac ventricle heart tube decreased length, abnormal WT + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
whole organism mir145 expression decreased amount, abnormal WT + MO2-ltbp3 control Fig. 6 with image from Gays et al., 2017
bulbus arteriosus lacks all parts of type smooth muscle myoblast, abnormal WT + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
heart looping decreased process quality, abnormal WT + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
lateral plate mesoderm tissue migration decreased process quality, abnormal pd24Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
lateral plate mesoderm tissue migration decreased occurrence, abnormal pd24Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
pharyngeal vasculature malformed, abnormal s843Tg + MO2-ltbp3 standard conditions Fig. S6 from Zhou et al., 2011
pharyngeal vasculature hypoplastic, abnormal s843Tg + MO2-ltbp3 standard conditions Fig. S6 from Zhou et al., 2011
intestine smooth muscle mCherry expression decreased amount, abnormal uto5Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
intestine smooth muscle ab1-tagln labeling decreased amount, abnormal uto5Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
cardiac ventricle has fewer parts of type ventricular endocardium, abnormal y7Tg + MO2-ltbp3 standard conditions Fig. 2 from Zhou et al., 2011
cardiac ventricle physical object quality, abnormal fb1Tg; fb2Tg + MO2-ltbp3 standard conditions Fig. 3 from Zhou et al., 2011
cardiac ventricle morphogenesis decreased process quality, abnormal fb1Tg; fb2Tg + MO2-ltbp3 standard conditions Fig. 3 from Zhou et al., 2011
presumptive bulbus arteriosus hypoplastic, abnormal fb2Tg; fb7Tg + MO2-ltbp3 standard conditions Fig. 3 from Zhou et al., 2011
outflow tract morphogenesis decreased process quality, abnormal fb2Tg; fb7Tg + MO2-ltbp3 standard conditions Fig. 3 from Zhou et al., 2011
intestine smooth muscle cell decreased amount, abnormal s854Tg; uto5Tg + MO2-ltbp3 control Fig. 3 with image from Gays et al., 2017
Citations