Morpholino

MO5-fgfr2

ID
ZDB-MRPHLNO-110725-2
Name
MO5-fgfr2
Previous Names
  • fgfr2c MO (1)
Target
Sequence
5' - AAGCAGTGGAAGGTGAGTTTATACC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-fgfr2
Expressed Gene Anatomy Figures
agr2 Fig. 4 with image from Liu et al., 2013
foxa3 Fig. 1 with image from Liu et al., 2011
foxj1a Fig. 4 with image from Liu et al., 2011
gcga Fig. 4 with image from Liu et al., 2013
lft1 Fig. 3 with image from Liu et al., 2011
Phenotype
Phenotype resulting from MO5-fgfr2
Phenotype Fish Figures
determination of liver left/right asymmetry disrupted, abnormal WT + MO5-fgfr2 Fig. 1 with image from Liu et al., 2011
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO5-fgfr2 Fig. 1 with image from Liu et al., 2011
heart jogging disrupted, abnormal cy1Tg + MO5-fgfr2 Fig. 2 with image from Liu et al., 2011
heart looping disrupted, abnormal cy1Tg + MO5-fgfr2 Fig. 2 with image from Liu et al., 2011
intestine has fewer parts of type goblet cell, abnormal WT + MO5-fgfr2 Fig. 3 with image,  Fig. 4 with image from Liu et al., 2013
intestine has fewer parts of type enteroendocrine cell, abnormal WT + MO5-fgfr2 Fig. 3 with image,  Fig. 4 with image from Liu et al., 2013
intestine cell population proliferation increased process quality, abnormal WT + MO5-fgfr2 Fig. 7 with image from Liu et al., 2013
Kupffer's vesicle cilium decreased amount, abnormal WT + MO5-fgfr2 Fig. 4 with image from Liu et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO5-fgfr2 Fig. 4 with image from Liu et al., 2011
left/right pattern formation disrupted, abnormal WT + MO5-fgfr2 Fig. 3 with image from Liu et al., 2011
Phenotype of all Fish created by or utilizing MO5-fgfr2
Phenotype Fish Conditions Figures
intestine has fewer parts of type goblet cell, abnormal WT + MO5-fgfr2 standard conditions Fig. 3 with image,  Fig. 4 with image from Liu et al., 2013
intestine cell population proliferation increased process quality, abnormal WT + MO5-fgfr2 standard conditions Fig. 7 with image from Liu et al., 2013
left/right pattern formation disrupted, abnormal WT + MO5-fgfr2 standard conditions Fig. 3 with image from Liu et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO5-fgfr2 standard conditions Fig. 4 with image from Liu et al., 2011
intestine has fewer parts of type enteroendocrine cell, abnormal WT + MO5-fgfr2 standard conditions Fig. 3 with image,  Fig. 4 with image from Liu et al., 2013
Kupffer's vesicle cilium decreased amount, abnormal WT + MO5-fgfr2 standard conditions Fig. 4 with image from Liu et al., 2011
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO5-fgfr2 standard conditions Fig. 1 with image from Liu et al., 2011
determination of liver left/right asymmetry disrupted, abnormal WT + MO5-fgfr2 standard conditions Fig. 1 with image from Liu et al., 2011
heart looping disrupted, abnormal cy1Tg + MO5-fgfr2 standard conditions Fig. 2 with image from Liu et al., 2011
heart jogging disrupted, abnormal cy1Tg + MO5-fgfr2 standard conditions Fig. 2 with image from Liu et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.