Morpholino

MO2-ttll6

ID

ZDB-MRPHLNO-110628-7

Name

MO2-ttll6

Previous Names

ttll6ATGMo (1)

Target

ttll6 (1)

Sequence

5' - CTGGTGTCCCCATTCTGATCTCTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ttll6

No data available

Phenotype

Phenotype resulting from MO2-ttll6

Phenotype	Fish	Figures
cilium movement amplitude, abnormal	AB/TU + MO2-ttll6	Fig. 5 from Pathak et al., 2011
head hydrocephalic, abnormal	AB/TU + MO2-ttll6	Fig. 5 from Pathak et al., 2011
heart edematous, abnormal	WT + MO2-ttll6	Fig. 4 from Lee et al., 2012
inner ear altered number of otolith, abnormal	WT + MO2-ttll6	Fig. 4 from Lee et al., 2012
inner ear lacks parts or has fewer parts of type otolith, abnormal	AB/TU + MO2-ttll6	Fig. 3, Fig. 5 from Pathak et al., 2011
post-vent region curved, abnormal	WT + MO2-ttll6	Fig. 4 from Lee et al., 2012
post-vent region morphology, abnormal	WT + MO2-ttll6	Fig. 4 from Lee et al., 2012
pronephric duct axonemal microtubule decreased size, abnormal	WT + MO2-ttll6	Fig. 4, Fig. S11 from Lee et al., 2012
pronephric duct axonemal microtubule increased amount, abnormal	WT + MO2-ttll6	Fig. 4, Fig. S11 from Lee et al., 2012
pronephric duct axoneme morphology, abnormal	WT + MO2-ttll6	Fig. 4, Fig. S11 from Lee et al., 2012
pronephros cystic, abnormal	AB/TU + MO2-ttll6	Fig. 4 from Lee et al., 2012 Fig. 3, Fig. 5 from Pathak et al., 2011
tubulin-glutamic acid ligase activity disrupted, abnormal	AB/TU + MO2-ttll6	Fig. 3 from Pathak et al., 2011
whole organism anterior-posterior axis curved ventral, abnormal	AB/TU + MO2-ttll6	Fig. 3, Fig. 5 from Pathak et al., 2011

Phenotype of all Fish created by or utilizing MO2-ttll6

Phenotype	Fish	Conditions	Figures
whole organism anterior-posterior axis curved ventral, abnormal	AB/TU + MO2-ttll6	standard conditions	Fig. 3, Fig. 5 from Pathak et al., 2011
inner ear lacks parts or has fewer parts of type otolith, abnormal	AB/TU + MO2-ttll6	standard conditions	Fig. 3, Fig. 5 from Pathak et al., 2011
tubulin-glutamic acid ligase activity disrupted, abnormal	AB/TU + MO2-ttll6	standard conditions	Fig. 3 from Pathak et al., 2011
cilium movement amplitude, abnormal	AB/TU + MO2-ttll6	standard conditions	Fig. 5 from Pathak et al., 2011
head hydrocephalic, abnormal	AB/TU + MO2-ttll6	standard conditions	Fig. 5 from Pathak et al., 2011
pronephros cystic, abnormal	AB/TU + MO2-ttll6	standard conditions	Fig. 3, Fig. 5 from Pathak et al., 2011
heart edematous, abnormal	WT + MO2-ttll6	standard conditions	Fig. 4 from Lee et al., 2012
pronephros cystic, abnormal	WT + MO2-ttll6	standard conditions	Fig. 4 from Lee et al., 2012
pronephric duct axonemal microtubule increased amount, abnormal	WT + MO2-ttll6	standard conditions	Fig. 4, Fig. S11 from Lee et al., 2012
pronephric duct axonemal microtubule decreased size, abnormal	WT + MO2-ttll6	standard conditions	Fig. 4, Fig. S11 from Lee et al., 2012
post-vent region morphology, abnormal	WT + MO2-ttll6	standard conditions	Fig. 4 from Lee et al., 2012
pronephric duct axoneme morphology, abnormal	WT + MO2-ttll6	standard conditions	Fig. 4, Fig. S11 from Lee et al., 2012
post-vent region curved, abnormal	WT + MO2-ttll6	standard conditions	Fig. 4 from Lee et al., 2012
inner ear altered number of otolith, abnormal	WT + MO2-ttll6	standard conditions	Fig. 4 from Lee et al., 2012
pronephros cystic, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
inner ear lacks parts or has fewer parts of type otolith, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
pronephros cilium uncoordinated, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
whole organism anterior-posterior axis curved ventral, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
cilium movement amplitude, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
pronephros axoneme structure, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 6 from Pathak et al., 2011
cilium movement irregular rhythm, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 5 from Pathak et al., 2011
pronephros axonemal dynein complex decreased amount, abnormal	AB/TU + MO2-ttll6 + MO3-ttll3	standard conditions	Fig. 6 from Pathak et al., 2011

Citations