Morpholino

MO1-tnnt3a

ID
ZDB-MRPHLNO-110228-3
Name
MO1-tnnt3a
Previous Names
None
Target
Sequence
5' - CTCAATGTCCTCTGTGTCTGACATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tnnt3a
No data available
Phenotype
Phenotype resulting from MO1-tnnt3a
Phenotype of all Fish created by or utilizing MO1-tnnt3a
Phenotype Fish Conditions Figures
trunk muscle refractivity, abnormal WT + MO1-tnnt3a standard conditions Fig. 4 from Ferrante et al., 2011
fast muscle cell actin filament distributed, abnormal WT + MO1-tnnt3a standard conditions Fig. 6 from Ferrante et al., 2011
fast muscle cell myofibril degenerate, abnormal WT + MO1-tnnt3a standard conditions Fig. 6 from Ferrante et al., 2011
fast muscle cell actin filament disorganized, abnormal WT + MO1-tnnt3a standard conditions Fig. 4 from Ferrante et al., 2011
skeletal muscle sarcomere disorganized, abnormal WT + MO1-tnnt3a standard conditions Fig. 4 from Ferrante et al., 2011
fast muscle cell myofibril undulate, abnormal dultu45/tu45 + MO1-tnnt3a standard conditions Fig. 6 from Ferrante et al., 2011
fast muscle cell actin filament undistributed, abnormal dultu45/tu45 + MO1-tnnt3a standard conditions Fig. 6 from Ferrante et al., 2011
fast muscle cell muscle thin filament tropomyosin absent, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
somite shape, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions text only from Ferrante et al., 2011
actin filament bundle distribution disrupted, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 2 from Ferrante et al., 2011
fast muscle cell filamentous actin decreased amount, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
striated muscle cell development disrupted, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
skeletal muscle Z disc disorganized, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1Fig. 2 from Ferrante et al., 2011
skeletal muscle sarcomere disorganized, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 3 from Ferrante et al., 2011
skeletal muscle M band dispersed, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 2 from Ferrante et al., 2011
whole organism immobile, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions text only from Ferrante et al., 2011
fast muscle cell myosin filament dispersed, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 2 from Ferrante et al., 2011
sarcomere organization disrupted, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
fast muscle cell myofibril disorganized, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
pericardium edematous, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions text only from Ferrante et al., 2011
whole organism bent, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions text only from Ferrante et al., 2011
Citations