Morpholino
MO2-supt5h
- ID
- ZDB-MRPHLNO-110210-1
- Name
- MO2-supt5h
- Previous Names
-
- zspt5MO (1)
- Target
- Sequence
-
5' - GTCCTCGCTGTCTGACATCTCTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-supt5h
Expressed Gene | Anatomy | Figures |
---|---|---|
alas2 |
Fig. 4
from Taneda et al., 2011 |
|
fli1 |
Fig. 6
from Taneda et al., 2011 |
|
gata1a |
Fig. 3,
Fig. 7
from Taneda et al., 2011 |
|
gata2a |
Fig. 5
from Taneda et al., 2011 |
|
hbae3 |
Fig. 4
from Taneda et al., 2011 |
|
kdrl |
Fig. 6
from Taneda et al., 2011 |
|
klf17 |
Fig. 5
from Taneda et al., 2011 |
|
lmo2 |
Fig. 5
from Taneda et al., 2011 |
|
pax2a |
Fig. 6
from Taneda et al., 2011 |
|
supt5h |
Fig. 1,
Fig. 7
from Taneda et al., 2011 |
|
tal1 |
Fig. 5
from Taneda et al., 2011 |
Phenotype
Phenotype resulting from MO2-supt5h
Phenotype of all Fish created by or utilizing MO2-supt5h
Citations