Morpholino

MO1-mfn2

ID
ZDB-MRPHLNO-110106-1
Name
MO1-mfn2
Previous Names
None
Target
Sequence
5' - GTTTCTGTTAAAGGGAAAACGGGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mfn2
No data available
Phenotype
Phenotype resulting from MO1-mfn2
Phenotype Fish Figures
axon extension disrupted, abnormal WT + MO1-mfn2 Fig. 3 from Vettori et al., 2011
brain edematous, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
CaP motoneuron branchiness, abnormal ml2Tg + MO1-mfn2 Fig. 4 from Vettori et al., 2011
CaP motoneuron disorganized, abnormal ml2Tg + MO1-mfn2 Fig. 4 from Vettori et al., 2011
eye decreased size, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
head decreased size, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
head necrotic, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
mandibular arch skeleton morphology, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
motor neuron axon absent, abnormal WT + MO1-mfn2 Fig. 3 from Vettori et al., 2011
motor neuron axon branchiness, abnormal WT + MO1-mfn2 Fig. 3 from Vettori et al., 2011
motor neuron axon truncated, abnormal WT + MO1-mfn2 Fig. 3 from Vettori et al., 2011
neuromuscular junction development disrupted, abnormal ml2Tg + MO1-mfn2 Fig. 4 from Vettori et al., 2011
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-mfn2 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-mfn2 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-mfn2 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-mfn2 Fig. 5 with image from Gonzaga-Jauregui et al., 2015
post-vent region increased curvature, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
RoP motor neuron decreased length, abnormal ml2Tg + MO1-mfn2 Fig. 4 from Vettori et al., 2011
RoP motor neuron immature, abnormal ml2Tg + MO1-mfn2 Fig. 4 from Vettori et al., 2011
sensory perception of touch disrupted, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal ml2Tg + MO1-mfn2 Fig. 4 from Vettori et al., 2011
skeletal muscle cell myofibril decreased thickness, abnormal WT + MO1-mfn2 Fig. 5 from Vettori et al., 2011
skeletal muscle cell myofibril disorganized, abnormal WT + MO1-mfn2 Fig. 5 from Vettori et al., 2011
somite decreased thickness, abnormal WT + MO1-mfn2 Fig. 5 from Vettori et al., 2011
somite irregular spatial pattern, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
somite U-shaped, abnormal WT + MO1-mfn2 Fig. 5 from Vettori et al., 2011
trunk edematous, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
whole organism decreased length, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
yolk distended, abnormal WT + MO1-mfn2 Fig. 2 from Vettori et al., 2011
Phenotype of all Fish created by or utilizing MO1-mfn2
Phenotype Fish Conditions Figures
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
motor neuron axon truncated, abnormal WT + MO1-mfn2 standard conditions Fig. 3 from Vettori et al., 2011
skeletal muscle cell myofibril decreased thickness, abnormal WT + MO1-mfn2 standard conditions Fig. 5 from Vettori et al., 2011
motor neuron axon branchiness, abnormal WT + MO1-mfn2 standard conditions Fig. 3 from Vettori et al., 2011
somite decreased thickness, abnormal WT + MO1-mfn2 standard conditions Fig. 5 from Vettori et al., 2011
whole organism decreased length, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
skeletal muscle cell myofibril disorganized, abnormal WT + MO1-mfn2 standard conditions Fig. 5 from Vettori et al., 2011
trunk edematous, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
somite irregular spatial pattern, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
axon extension disrupted, abnormal WT + MO1-mfn2 standard conditions Fig. 3 from Vettori et al., 2011
head decreased size, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
head necrotic, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
mandibular arch skeleton morphology, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
sensory perception of touch disrupted, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
eye decreased size, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
somite U-shaped, abnormal WT + MO1-mfn2 standard conditions Fig. 5 from Vettori et al., 2011
motor neuron axon absent, abnormal WT + MO1-mfn2 standard conditions Fig. 3 from Vettori et al., 2011
yolk distended, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
post-vent region increased curvature, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
brain edematous, abnormal WT + MO1-mfn2 standard conditions Fig. 2 from Vettori et al., 2011
CaP motoneuron disorganized, abnormal ml2Tg + MO1-mfn2 standard conditions Fig. 4 from Vettori et al., 2011
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal ml2Tg + MO1-mfn2 standard conditions Fig. 4 from Vettori et al., 2011
RoP motor neuron immature, abnormal ml2Tg + MO1-mfn2 standard conditions Fig. 4 from Vettori et al., 2011
RoP motor neuron decreased length, abnormal ml2Tg + MO1-mfn2 standard conditions Fig. 4 from Vettori et al., 2011
neuromuscular junction development disrupted, abnormal ml2Tg + MO1-mfn2 standard conditions Fig. 4 from Vettori et al., 2011
CaP motoneuron branchiness, abnormal ml2Tg + MO1-mfn2 standard conditions Fig. 4 from Vettori et al., 2011
peripheral neuron axon shape, abnormal AB/EKW + MO1-gdap1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-gdap1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-gdap1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-gdap1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-hspb1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-hspb1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-hspb1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-hspb1 + MO1-mfn2 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-mfn2 + MO2-med25 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon absent, abnormal AB/EKW + MO1-mfn2 + MO2-med25 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-mfn2 + MO2-med25 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-mfn2 + MO2-med25 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-mfn2 + MO2-med25 standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon shape, abnormal AB/EKW + MO1-mfn2 + MO5-wnk1b standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon absent, abnormal AB/EKW + MO1-mfn2 + MO5-wnk1b standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon branchiness, abnormal AB/EKW + MO1-mfn2 + MO5-wnk1b standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon guidance process quality, abnormal AB/EKW + MO1-mfn2 + MO5-wnk1b standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
peripheral neuron axon morphology, abnormal AB/EKW + MO1-mfn2 + MO5-wnk1b standard conditions Fig. 5 with image from Gonzaga-Jauregui et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.