Morpholino

MO1-abcc6a

ID

ZDB-MRPHLNO-101228-2

Name

MO1-abcc6a

Previous Names

Target

Sequence

5' - CACTTAGACTGCAAAAGGTATCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

A translation start site targeting morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-abcc6a

No data available

Phenotype

Phenotype resulting from MO1-abcc6a

Phenotype	Fish	Figures
embryo development disrupted, abnormal	WT + MO1-abcc6a	Fig. 3 from Jin et al., 2015 Fig. 4 from Pomozi et al., 2014
head development delayed, abnormal	WT + MO1-abcc6a	Fig. 5 from Li et al., 2010
pericardium edematous, abnormal	WT + MO1-abcc6a	Fig. 3 from Jin et al., 2015 Fig. 5 from Li et al., 2010
post-vent region decreased length, abnormal	WT + MO1-abcc6a	Fig. 5 from Li et al., 2010
post-vent region increased curvature, abnormal	WT + MO1-abcc6a	Fig. 3 from Jin et al., 2015
trunk curved, abnormal	WT + MO1-abcc6a	Fig. 5 from Li et al., 2010
whole organism decreased length, abnormal	WT + MO1-abcc6a	Fig. 5 from Li et al., 2010
whole organism decreased size, abnormal	WT + MO1-abcc6a	Fig. 3 from Jin et al., 2015
whole organism viability, abnormal	WT + MO1-abcc6a	text only from Jin et al., 2015

Phenotype of all Fish created by or utilizing MO1-abcc6a

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	WT + MO1-abcc6a	standard conditions	Fig. 3 from Jin et al., 2015 Fig. 5 from Li et al., 2010
whole organism viability, abnormal	WT + MO1-abcc6a	standard conditions	text only from Jin et al., 2015
embryo development disrupted, abnormal	WT + MO1-abcc6a	standard conditions	Fig. 3 from Jin et al., 2015 Fig. 4 from Pomozi et al., 2014
post-vent region decreased length, abnormal	WT + MO1-abcc6a	standard conditions	Fig. 5 from Li et al., 2010
whole organism decreased size, abnormal	WT + MO1-abcc6a	standard conditions	Fig. 3 from Jin et al., 2015
post-vent region increased curvature, abnormal	WT + MO1-abcc6a	standard conditions	Fig. 3 from Jin et al., 2015
whole organism decreased length, abnormal	WT + MO1-abcc6a	standard conditions	Fig. 5 from Li et al., 2010
trunk curved, abnormal	WT + MO1-abcc6a	standard conditions	Fig. 5 from Li et al., 2010
head development delayed, abnormal	WT + MO1-abcc6a	standard conditions	Fig. 5 from Li et al., 2010

Citations