Morpholino

MO1-dmbx1b

ID

ZDB-MRPHLNO-101027-2

Name

MO1-dmbx1b

Previous Names

MO1b (1)

Target

dmbx1b (1)

Sequence

5' - TCGAGCTTCTCTCTGGGAAGTTTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dmbx1b

Expressed Gene	Anatomy	Figures
foxb1a	diencephalon ventral region midbrain midbrain hindbrain boundary	Fig. 4 from Wong et al., 2010

Phenotype

Phenotype resulting from MO1-dmbx1b

Phenotype	Fish	Figures
optic tectum decreased size, abnormal	AB + MO1-dmbx1b	Fig. 3 from Wong et al., 2010
retina decreased thickness, abnormal	AB + MO1-dmbx1b	Fig. 5 from Wong et al., 2010
retina development in camera-type eye disrupted, abnormal	AB + MO1-dmbx1b	Fig. 5 from Wong et al., 2010
retina layer formation disrupted, abnormal	AB + MO1-dmbx1b	Fig. 5 from Wong et al., 2010

Phenotype of all Fish created by or utilizing MO1-dmbx1b

Phenotype	Fish	Conditions	Figures
retina layer formation disrupted, abnormal	AB + MO1-dmbx1b	standard conditions	Fig. 5 from Wong et al., 2010
retina development in camera-type eye disrupted, abnormal	AB + MO1-dmbx1b	standard conditions	Fig. 5 from Wong et al., 2010
retina decreased thickness, abnormal	AB + MO1-dmbx1b	standard conditions	Fig. 5 from Wong et al., 2010
optic tectum decreased size, abnormal	AB + MO1-dmbx1b	standard conditions	Fig. 3 from Wong et al., 2010
amacrine cell absent, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 8 from Wong et al., 2015
retina central region ccnd1 expression increased amount, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 7 from Wong et al., 2015
cell population proliferation disrupted, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 7 from Wong et al., 2010
retina decreased thickness, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 5 from Wong et al., 2010
retina layer formation disrupted, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 5 from Wong et al., 2010
retina development in camera-type eye disrupted, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 5 from Wong et al., 2010
cell cycle increased duration, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 8 from Wong et al., 2010
head vsx2 expression increased amount, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 2 from Wong et al., 2015
retinal cone cell decreased amount, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 8 from Wong et al., 2015
retina peripheral region ccnd1 expression increased amount, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 7 from Wong et al., 2015
lens decreased size, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 5 from Wong et al., 2010
retina ccnd1 expression increased amount, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 7 from Wong et al., 2015
lens fiber cell differentiation disrupted, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 5 from Wong et al., 2010
retina central region vsx2 expression increased amount, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 2 from Wong et al., 2015
optic tectum morphology, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 3 from Wong et al., 2010
amacrine cell decreased amount, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 8 from Wong et al., 2015
retinal cone cell absent, abnormal	AB + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 8 from Wong et al., 2015
retinal cone cell amount, ameliorated	AB + MO1-ccnd1 + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 8 from Wong et al., 2015
retina zpr-1 labeling absent, abnormal	AB + MO1-ccnd1 + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 8 from Wong et al., 2015
amacrine cell amount, ameliorated	AB + MO1-ccnd1 + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 8 from Wong et al., 2015
amacrine cell decreased amount, abnormal	zc7Tg + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 6 from Wong et al., 2010
retina neuronal stem cell undifferentiated, abnormal	zc7Tg + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 6 from Wong et al., 2010
retinal ganglion cell decreased amount, abnormal	zc7Tg + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 6 from Wong et al., 2010
retinal bipolar neuron decreased amount, abnormal	zc7Tg + MO1-dmbx1a + MO1-dmbx1b	standard conditions	Fig. 6 from Wong et al., 2010

Citations