Morpholino

MO4-ptpn11a

ID
ZDB-MRPHLNO-101026-5
Name
MO4-ptpn11a
Previous Names
  • MO4-ptpn11
  • Shp2 Ex3-MO (1)
Target
Sequence
5' - AGGTATGTATGTGCTCACCTCTCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets exon 3
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-ptpn11a
No data available
Phenotype
Phenotype resulting from MO4-ptpn11a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO4-ptpn11a Fig. 3 with imageFig. 4 with image from Stewart et al., 2010
caudal fin decreased size, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
convergent extension disrupted, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
dorsal root ganglion neuron decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
dorsal root ganglion neuron displaced, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
enteric nervous system neuron decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
epibranchial ganglion decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
lateral line cell population proliferation decreased occurrence, abnormal s356tTg + MO4-ptpn11a Fig. 3 from Gao et al., 2020
mandibular arch skeleton non-functional, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
melanocyte decreased amount, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
melanocyte mislocalised, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
neural crest cell migration delayed, abnormal WT + MO4-ptpn11a Fig. 2 with image from Stewart et al., 2010
neural crest cell migration process quality, abnormal WT + MO4-ptpn11a Fig. 2 with image from Stewart et al., 2010
neuromast hair cell decreased amount, abnormal WT + MO4-ptpn11a Fig. 3Fig. 4 from Gao et al., 2020
neuromast support cell decreased amount, abnormal s356tTg + MO4-ptpn11a Fig. 3 from Gao et al., 2020
otolith decreased size, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
pericardium edematous, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
pharyngeal arch 1 displaced, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 1 structure, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 displaced, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 structure, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 3-7 aplastic, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pigmentation disrupted, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
posterior lateral line neuron decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
swim bladder uninflated, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
sympathetic nervous system neuron decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
trigeminal ganglion decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
whole organism lef1 expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism fzd7a expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism axin2 expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism dkk1b expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism lrp5 expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism ptgs2a expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
Phenotype of all Fish created by or utilizing MO4-ptpn11a
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 3-7 aplastic, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
otolith decreased size, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
whole organism lef1 expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
neural crest cell migration process quality, abnormal WT + MO4-ptpn11a standard conditions Fig. 2 with image from Stewart et al., 2010
pharyngeal arch 1 displaced, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 displaced, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
neuromast hair cell decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 3Fig. 4 from Gao et al., 2020
pharyngeal arch 2 structure, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
pigmentation disrupted, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
pharyngeal arch 1 structure, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
neural crest cell migration delayed, abnormal WT + MO4-ptpn11a standard conditions Fig. 2 with image from Stewart et al., 2010
apoptotic process increased occurrence, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 with imageFig. 4 with image from Stewart et al., 2010
whole organism fzd7a expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
whole organism axin2 expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
enteric nervous system neuron decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
mandibular arch skeleton non-functional, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
whole organism ptgs2a expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
caudal fin decreased size, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
dorsal root ganglion neuron displaced, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
pericardium edematous, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
swim bladder uninflated, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
dorsal root ganglion neuron decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
epibranchial ganglion decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
posterior lateral line neuron decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
melanocyte mislocalised, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
whole organism dkk1b expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
melanocyte decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
trigeminal ganglion decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
sympathetic nervous system neuron decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
whole organism lrp5 expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
neuromast support cell decreased amount, abnormal s356tTg + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
lateral line cell population proliferation decreased occurrence, abnormal s356tTg + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
neuromast hair cell decreased amount, abnormal s356tTg + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
Citations