Morpholino

MO4-ptpn11a

ID
ZDB-MRPHLNO-101026-5
Name
MO4-ptpn11a
Previous Names
  • MO4-ptpn11
  • Shp2 Ex3-MO (1)
Target
Sequence
5' - AGGTATGTATGTGCTCACCTCTCGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets exon 3
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-ptpn11a
Expressed Gene Anatomy Figures
axin2 Fig. 4 from Gao et al., 2020
crestin Fig. 3 with image from Stewart et al., 2010
dkk1b Fig. 4 from Gao et al., 2020
dlx2a Fig. 3 with image from Stewart et al., 2010
foxd3 Fig. 2 with image from Stewart et al., 2010
fzd7a Fig. 4 from Gao et al., 2020
lef1 Fig. 4 from Gao et al., 2020
lrp5 Fig. 4 from Gao et al., 2020
ptgs2a Fig. 4 from Gao et al., 2020
sox10 Fig. 2 with image from Stewart et al., 2010
th Fig. S1 with image from Stewart et al., 2010
tuba8l3 Fig. 3 with image from Stewart et al., 2010
Phenotype
Phenotype resulting from MO4-ptpn11a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO4-ptpn11a Fig. 3 with image,  Fig. 4 with image from Stewart et al., 2010
caudal fin decreased size, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
convergent extension disrupted, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
dorsal root ganglion neuron decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
dorsal root ganglion neuron displaced, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
enteric nervous system neuron decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
epibranchial ganglion decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
lateral line cell population proliferation decreased occurrence, abnormal s356tTg + MO4-ptpn11a Fig. 3 from Gao et al., 2020
mandibular arch skeleton non-functional, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
melanocyte decreased amount, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
melanocyte mislocalised, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
neural crest cell migration delayed, abnormal WT + MO4-ptpn11a Fig. 2 with image from Stewart et al., 2010
neural crest cell migration process quality, abnormal WT + MO4-ptpn11a Fig. 2 with image from Stewart et al., 2010
neuromast hair cell decreased amount, abnormal WT + MO4-ptpn11a Fig. 3,  Fig. 4 from Gao et al., 2020
neuromast support cell decreased amount, abnormal s356tTg + MO4-ptpn11a Fig. 3 from Gao et al., 2020
otolith decreased size, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
pericardium edematous, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
pharyngeal arch 1 displaced, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 1 structure, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 displaced, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 structure, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 3-7 aplastic, abnormal WT + MO4-ptpn11a Fig. 1 with image from Stewart et al., 2010
pigmentation disrupted, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
posterior lateral line neuron decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
swim bladder uninflated, abnormal WT + MO4-ptpn11a Fig. 3 from Gao et al., 2020
sympathetic nervous system neuron decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
trigeminal ganglion decreased amount, abnormal WT + MO4-ptpn11a Fig. S1 with image from Stewart et al., 2010
whole organism lef1 expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism fzd7a expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism axin2 expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism dkk1b expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism lrp5 expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
whole organism ptgs2a expression decreased amount, abnormal WT + MO4-ptpn11a Fig. 4 from Gao et al., 2020
Phenotype of all Fish created by or utilizing MO4-ptpn11a
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 3-7 aplastic, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
otolith decreased size, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
whole organism lef1 expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
neural crest cell migration process quality, abnormal WT + MO4-ptpn11a standard conditions Fig. 2 with image from Stewart et al., 2010
pharyngeal arch 1 displaced, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
pharyngeal arch 2 displaced, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
neuromast hair cell decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 3,  Fig. 4 from Gao et al., 2020
pharyngeal arch 2 structure, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
pigmentation disrupted, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
pharyngeal arch 1 structure, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
neural crest cell migration delayed, abnormal WT + MO4-ptpn11a standard conditions Fig. 2 with image from Stewart et al., 2010
apoptotic process increased occurrence, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 with image,  Fig. 4 with image from Stewart et al., 2010
whole organism fzd7a expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
whole organism axin2 expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
enteric nervous system neuron decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
mandibular arch skeleton non-functional, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
whole organism ptgs2a expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
caudal fin decreased size, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
dorsal root ganglion neuron displaced, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
pericardium edematous, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
swim bladder uninflated, abnormal WT + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
dorsal root ganglion neuron decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
epibranchial ganglion decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
posterior lateral line neuron decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
melanocyte mislocalised, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
whole organism dkk1b expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
melanocyte decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 1 with image from Stewart et al., 2010
trigeminal ganglion decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
sympathetic nervous system neuron decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. S1 with image from Stewart et al., 2010
whole organism lrp5 expression decreased amount, abnormal WT + MO4-ptpn11a standard conditions Fig. 4 from Gao et al., 2020
neuromast support cell decreased amount, abnormal s356tTg + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
lateral line cell population proliferation decreased occurrence, abnormal s356tTg + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
neuromast hair cell decreased amount, abnormal s356tTg + MO4-ptpn11a standard conditions Fig. 3 from Gao et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.