Morpholino

MO1-spg11

ID
ZDB-MRPHLNO-101017-1
Name
MO1-spg11
Previous Names
  • spg11E2I2 (1)
Target
Sequence
5' - GTGATGTTCAGTTCTCTTACCGGCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-spg11
No data available
Phenotype
Phenotype resulting from MO1-spg11
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
commissural neuron axon guidance disrupted, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
cranial nerve development disrupted, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
eye decreased size, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
hindbrain glial cell decreased amount, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
hindbrain development disrupted, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
midbrain hindbrain boundary decreased size, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
motor neuron axon decreased length, abnormal WT + MO1-spg11 Fig. 4,  Fig. S1 from Southgate et al., 2010
motor neuron axon disorganized, abnormal WT + MO1-spg11 Fig. 4,  Fig. S1 from Southgate et al., 2010
retinal ganglion cell decreased amount, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
somite morphology, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
spinal cord development disrupted, abnormal WT + MO1-spg11 Fig. 4,  Fig. S1 from Southgate et al., 2010
ventricular system development disrupted, abnormal WT + MO1-spg11 Fig. 4 from Southgate et al., 2010
Phenotype of all Fish created by or utilizing MO1-spg11
Phenotype Fish Conditions Figures
hindbrain development disrupted, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
motor neuron axon disorganized, abnormal WT + MO1-spg11 standard conditions Fig. 4,  Fig. S1 from Southgate et al., 2010
cranial nerve development disrupted, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
motor neuron axon decreased length, abnormal WT + MO1-spg11 standard conditions Fig. 4,  Fig. S1 from Southgate et al., 2010
hindbrain glial cell decreased amount, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
midbrain hindbrain boundary decreased size, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
eye decreased size, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
commissural neuron axon guidance disrupted, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
retinal ganglion cell decreased amount, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
somite morphology, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
brain hydrocephalic, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
spinal cord development disrupted, abnormal WT + MO1-spg11 standard conditions Fig. 4,  Fig. S1 from Southgate et al., 2010
ventricular system development disrupted, abnormal WT + MO1-spg11 standard conditions Fig. 4 from Southgate et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.