Morpholino

MO1-pknox1.2

ID
ZDB-MRPHLNO-100701-1
Name
MO1-pknox1.2
Previous Names
  • MO1-prep1.2 (1)
Target
Sequence
5' - GTCATCATAGTTACTGTTGCCGTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pknox1.2
Expressed Gene Anatomy Figures
aldh1a2 Fig. 6 with image from Vaccari et al., 2010
dlx2a Fig. 3 with image from Vaccari et al., 2010
fgf3 Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
foxd3 Fig. 3 with image from Vaccari et al., 2010
hoxb1b Fig. 6 with image from Vaccari et al., 2010
Phenotype
Phenotype resulting from MO1-pknox1.2
Phenotype Fish Figures
ceratohyal cartilage decreased size, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
ceratohyal cartilage malformed, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
endoderm development process quality, abnormal WT + MO1-pknox1.2 Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
Meckel's cartilage malformed, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
neural crest cell differentiation process quality, abnormal WT + MO1-pknox1.2 Fig. 3 with image from Vaccari et al., 2010
pectoral fin bud physical object quality, abnormal WT + MO1-pknox1.2 Fig. 6 with image from Vaccari et al., 2010
pharyngeal arch 3 skeleton decreased size, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
pharyngeal arch 3-7 physical object quality, abnormal WT + MO1-pknox1.2 Fig. 6 with image from Vaccari et al., 2010
pharyngeal arch 4 skeleton aplastic, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
pharyngeal arch 5 skeleton aplastic, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
pharyngeal arch 6 skeleton aplastic, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
pharyngeal arch 7 skeleton aplastic, abnormal WT + MO1-pknox1.2 Fig. 2 with image from Vaccari et al., 2010
pharyngeal pouch 3 aplastic, abnormal WT + MO1-pknox1.2 Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
pharyngeal pouch 4 aplastic, abnormal WT + MO1-pknox1.2 Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
pharyngeal pouch 5 aplastic, abnormal WT + MO1-pknox1.2 Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
pharyngeal pouch 6 aplastic, abnormal WT + MO1-pknox1.2 Fig. 5 with image from Vaccari et al., 2010
pharyngeal system development process quality, abnormal WT + MO1-pknox1.2 Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Vaccari et al., 2010
retinoic acid receptor signaling pathway process quality, abnormal WT + MO1-pknox1.2 Fig. 6 with image from Vaccari et al., 2010
Phenotype of all Fish created by or utilizing MO1-pknox1.2
Phenotype Fish Conditions Figures
pharyngeal arch 3 skeleton decreased size, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
pharyngeal pouch 6 aplastic, abnormal WT + MO1-pknox1.2 standard conditions Fig. 5 with image from Vaccari et al., 2010
pharyngeal arch 5 skeleton aplastic, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
pharyngeal pouch 5 aplastic, abnormal WT + MO1-pknox1.2 standard conditions Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
Meckel's cartilage malformed, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
pharyngeal arch 6 skeleton aplastic, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
pharyngeal pouch 4 aplastic, abnormal WT + MO1-pknox1.2 standard conditions Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
retinoic acid receptor signaling pathway process quality, abnormal WT + MO1-pknox1.2 standard conditions Fig. 6 with image from Vaccari et al., 2010
pharyngeal pouch 3 aplastic, abnormal WT + MO1-pknox1.2 standard conditions Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
pharyngeal arch 3-7 physical object quality, abnormal WT + MO1-pknox1.2 standard conditions Fig. 6 with image from Vaccari et al., 2010
pharyngeal system development process quality, abnormal WT + MO1-pknox1.2 standard conditions Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Vaccari et al., 2010
endoderm development process quality, abnormal WT + MO1-pknox1.2 standard conditions Fig. 3 with image,  Fig. 5 with image from Vaccari et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
pectoral fin bud physical object quality, abnormal WT + MO1-pknox1.2 standard conditions Fig. 6 with image from Vaccari et al., 2010
ceratohyal cartilage decreased size, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
pharyngeal arch 7 skeleton aplastic, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
ceratohyal cartilage malformed, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
pharyngeal arch 4 skeleton aplastic, abnormal WT + MO1-pknox1.2 standard conditions Fig. 2 with image from Vaccari et al., 2010
neural crest cell differentiation process quality, abnormal WT + MO1-pknox1.2 standard conditions Fig. 3 with image from Vaccari et al., 2010
endoderm development process quality, abnormal ia1Tg + MO1-pknox1.2 standard conditions Fig. 3 with image from Vaccari et al., 2010
pharyngeal pouch 5 aplastic, abnormal ia1Tg + MO1-pknox1.2 standard conditions Fig. 3 with image from Vaccari et al., 2010
pharyngeal pouch 3 aplastic, abnormal ia1Tg + MO1-pknox1.2 standard conditions Fig. 3 with image from Vaccari et al., 2010
pharyngeal system development process quality, abnormal ia1Tg + MO1-pknox1.2 standard conditions Fig. 3 with image from Vaccari et al., 2010
pharyngeal pouch 4 aplastic, abnormal ia1Tg + MO1-pknox1.2 standard conditions Fig. 3 with image from Vaccari et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.