Morpholino

MO2-atoh8

ID
ZDB-MRPHLNO-100624-2
Name
MO2-atoh8
Previous Names
  • Atoh8splI1E2 (1)
Target
Sequence
5' - GTACCTGTAAAAGTAGATCAAAGGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atoh8
No data available
Phenotype
Phenotype resulting from MO2-atoh8
Phenotype Fish Figures
blood circulation disrupted, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
brain shape, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
extension decreased length, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
eye decreased size, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
head hypotrophic, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
pharyngeal arch 3-7 decreased size, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
post-vent region decreased flexibility, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
somite fused with somite, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
somite U-shaped, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
somite border deformed, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
whole organism anterior-posterior axis curved ventral, abnormal AB + MO2-atoh8 + MO5-tp53 Fig. 5 with image from Yao et al., 2010
Phenotype of all Fish created by or utilizing MO2-atoh8
Phenotype Fish Conditions Figures
somite border deformed, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
blood circulation disrupted, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
pharyngeal arch 3-7 decreased size, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
brain shape, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
eye decreased size, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
somite U-shaped, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
post-vent region decreased flexibility, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
head hypotrophic, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
whole organism anterior-posterior axis curved ventral, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
somite fused with somite, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
extension decreased length, abnormal AB + MO2-atoh8 + MO5-tp53 standard conditions Fig. 5 with image from Yao et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.