Morpholino

MO1-atoh8

ID

ZDB-MRPHLNO-100624-1

Name

MO1-atoh8

Previous Names

Atoh8-MO1 (1)

Target

atoh8 (1)

Sequence

5' - TGTTTAGATGTGGGTTCTTCATTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-atoh8

No data available

Phenotype

Phenotype resulting from MO1-atoh8

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010
brain shape, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010
extension decreased length, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010
eye decreased size, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010
head hypotrophic, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010
pharyngeal arch 3-7 decreased size, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010
post-vent region decreased flexibility, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010
retina apoptotic, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 9 from Yao et al., 2010
retina decreased size, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 8 from Yao et al., 2010
retina disorganized, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 10 from Yao et al., 2010
retina morphology, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 9 from Yao et al., 2010
retina development in camera-type eye disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 10 from Yao et al., 2010
retina layer formation disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 8 from Yao et al., 2010
retinal ganglion cell decreased amount, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 8 from Yao et al., 2010
retinal neural layer morphology, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 8 from Yao et al., 2010
skeletal muscle cell disorganized, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 12 from Yao et al., 2010
skeletal muscle cell differentiation disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 12 from Yao et al., 2010
somite cuboid, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 12 from Yao et al., 2010
somite fused with somite, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010
somite U-shaped, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 , Fig. 11 , Fig. 12 from Yao et al., 2010
somite posterior-most region decreased amount, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 11 from Yao et al., 2010
somite border deformed, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 , Fig. 11 from Yao et al., 2010
somitogenesis disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 11 from Yao et al., 2010
vertical myoseptum decreased length, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 12 from Yao et al., 2010
vertical myoseptum structure, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 12 from Yao et al., 2010
whole organism anterior-posterior axis curved ventral, abnormal	AB + MO1-atoh8 + MO5-tp53	Fig. 4 from Yao et al., 2010

Phenotype of all Fish created by or utilizing MO1-atoh8

Phenotype	Fish	Conditions	Figures
somite posterior-most region decreased amount, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 11 from Yao et al., 2010
extension decreased length, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010
retinal ganglion cell decreased amount, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 8 from Yao et al., 2010
brain shape, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010
skeletal muscle cell differentiation disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 12 from Yao et al., 2010
pharyngeal arch 3-7 decreased size, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010
retina morphology, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 9 from Yao et al., 2010
somite cuboid, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 12 from Yao et al., 2010
somite U-shaped, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 , Fig. 11 , Fig. 12 from Yao et al., 2010
vertical myoseptum structure, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 12 from Yao et al., 2010
somite border deformed, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 , Fig. 11 from Yao et al., 2010
retina decreased size, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 8 from Yao et al., 2010
blood circulation disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010
retina layer formation disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 8 from Yao et al., 2010
retina disorganized, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 10 from Yao et al., 2010
skeletal muscle cell disorganized, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 12 from Yao et al., 2010
whole organism anterior-posterior axis curved ventral, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010
eye decreased size, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010
vertical myoseptum decreased length, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 12 from Yao et al., 2010
retinal neural layer morphology, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 8 from Yao et al., 2010
retina apoptotic, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 9 from Yao et al., 2010
retina development in camera-type eye disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 10 from Yao et al., 2010
somitogenesis disrupted, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 11 from Yao et al., 2010
head hypotrophic, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010
somite fused with somite, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010
post-vent region decreased flexibility, abnormal	AB + MO1-atoh8 + MO5-tp53	standard conditions	Fig. 4 from Yao et al., 2010

Citations