Morpholino

MO1-col6a1

ID
ZDB-MRPHLNO-100623-5
Name
MO1-col6a1
Previous Names
  • Exon 9 col6a1 (1)
Target
Sequence
5' - GAGAGCGGAAGACGAACCTTCATTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-col6a1
No data available
Phenotype
Phenotype resulting from MO1-col6a1
Phenotype Fish Figures
horizontal myoseptum Ab2-col6 labeling decreased amount, abnormal AB/TU + MO1-col6a1 Figure S3 from Tonelotto et al., 2019
larval locomotory behavior decreased process quality, abnormal WT + MO1-col6a1 Figure 6 with image from La Spina et al., 2021
muscle muscle tendon junction disorganized, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle muscle tendon junction morphology, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
muscle myofibril disorganized, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle T-tubule dilated, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle cell apoptotic, abnormal AB + MO1-col6a1 Fig. 7 from Telfer et al., 2010
muscle cell mitochondrial crista decreased amount, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle cell mitochondrial intermembrane space dilated, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle cell mitochondrion aggregated, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
muscle cell mitochondrion increased size, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle cell myofibril kinked, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
muscle cell myofibril misaligned with muscle cell myofibril, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
muscle cell myofibril separated from muscle cell muscle tendon junction, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 Fig. 1,  Fig. 8 from Telfer et al., 2010
myotome muscle tendon junction structure, abnormal AB + MO1-col6a1 Fig. 4,  Fig. 6 from Telfer et al., 2010
pericardium edematous, abnormal AB + MO1-col6a1 Fig. 2 from Telfer et al., 2010
post-vent region bent, abnormal AB + MO1-col6a1 Fig. 2 from Telfer et al., 2010
skeletal muscle morphology, abnormal AB + MO1-col6a1 Fig. 4 from Telfer et al., 2010
skeletal muscle refractivity, abnormal WT + MO1-col6a1 Fig. 4 from Zulian et al., 2014
skeletal muscle cell collagen trimer spatial pattern, abnormal AB + MO1-col6a1 Fig. 3 from Telfer et al., 2010
skeletal muscle cell endoplasmic reticulum dilated, abnormal AB + MO1-col6a1 Fig. 5,  Fig. 9 from Telfer et al., 2010
skeletal muscle cell mitochondrial crista structure, abnormal AB + MO1-col6a1 Fig. 5 from Telfer et al., 2010
skeletal muscle cell mitochondrion increased amount, abnormal AB + MO1-col6a1 Fig. 6 from Telfer et al., 2010
skeletal muscle cell mitochondrion swollen, abnormal AB + MO1-col6a1 Fig. 5,  Fig. 9 from Telfer et al., 2010
skeletal muscle cell myofibril structure, abnormal AB + MO1-col6a1 Fig. 10 from Telfer et al., 2010
skeletal muscle cell sarcolemma structure, abnormal AB + MO1-col6a1 Fig. 4 from Telfer et al., 2010
startle response disrupted, abnormal AB + MO1-col6a1 Fig. 1 from Telfer et al., 2010
thigmotaxis decreased process quality, abnormal WT + MO1-col6a1 Figure 6 with image from La Spina et al., 2021
thigmotaxis disrupted, abnormal WT + MO1-col6a1 Fig. 3 from Zulian et al., 2014
trunk bent, abnormal AB + MO1-col6a1 Fig. 1 from Zulian et al., 2014
Fig. 2 from Telfer et al., 2010
trunk skeletal muscle organization quality, abnormal WT + MO1-col6a1 Figure 6 with image from La Spina et al., 2021
vertical myoseptum Ab2-col6 labeling decreased amount, abnormal AB/TU + MO1-col6a1 Figure S3 from Tonelotto et al., 2019
whole organism decreased mobility, abnormal WT + MO1-col6a1 Fig. 2 from Zulian et al., 2014
whole organism decreased size, abnormal AB + MO1-col6a1 Fig. 1 from Zulian et al., 2014
Fig. 2 from Telfer et al., 2010
whole organism hypoplastic, abnormal AB + MO1-col6a1 Fig. 2 from Telfer et al., 2010
whole organism paralysed, abnormal WT + MO1-col6a1 Fig. 2 from Zulian et al., 2014
Phenotype of all Fish created by or utilizing MO1-col6a1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
skeletal muscle cell sarcolemma structure, abnormal AB + MO1-col6a1 standard conditions Fig. 4 from Telfer et al., 2010
skeletal muscle cell myofibril structure, abnormal AB + MO1-col6a1 chemical treatment: cyclosporin A Fig. 10 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 chemical treatment: cyclosporin A Fig. 8 from Telfer et al., 2010
skeletal muscle cell mitochondrion increased amount, abnormal AB + MO1-col6a1 standard conditions Fig. 6 from Telfer et al., 2010
myotome muscle tendon junction structure, abnormal AB + MO1-col6a1 standard conditions Fig. 4,  Fig. 6 from Telfer et al., 2010
skeletal muscle cell collagen trimer spatial pattern, abnormal AB + MO1-col6a1 standard conditions Fig. 3 from Telfer et al., 2010
skeletal muscle morphology, abnormal AB + MO1-col6a1 standard conditions Fig. 4 from Telfer et al., 2010
whole organism decreased size, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
skeletal muscle cell mitochondrial crista structure, abnormal AB + MO1-col6a1 standard conditions Fig. 5 from Telfer et al., 2010
post-vent region bent, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 standard conditions Fig. 1,  Fig. 8 from Telfer et al., 2010
startle response disrupted, abnormal AB + MO1-col6a1 standard conditions Fig. 1 from Telfer et al., 2010
skeletal muscle cell mitochondrion swollen, abnormal AB + MO1-col6a1 standard conditions Fig. 5,  Fig. 9 from Telfer et al., 2010
skeletal muscle cell myofibril structure, abnormal AB + MO1-col6a1 standard conditions Fig. 10 from Telfer et al., 2010
whole organism hypoplastic, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
trunk bent, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
skeletal muscle cell endoplasmic reticulum dilated, abnormal AB + MO1-col6a1 standard conditions Fig. 5,  Fig. 9 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 standard conditions Fig. 7 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 chemical treatment: cyclosporin A Fig. 7 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 8 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 7 from Telfer et al., 2010
vertical myoseptum Ab2-col6 labeling decreased amount, abnormal AB/TU + MO1-col6a1 standard conditions Figure S3 from Tonelotto et al., 2019
horizontal myoseptum Ab2-col6 labeling decreased amount, abnormal AB/TU + MO1-col6a1 standard conditions Figure S3 from Tonelotto et al., 2019
skeletal muscle refractivity, abnormal WT + MO1-col6a1 standard conditions Fig. 4 from Zulian et al., 2014
muscle muscle tendon junction disorganized, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
trunk bent, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
larval locomotory behavior decreased process quality, abnormal WT + MO1-col6a1 control Figure 6 with image from La Spina et al., 2021
muscle cell mitochondrial intermembrane space dilated, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
muscle cell mitochondrion aggregated, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
muscle myofibril disorganized, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
muscle muscle tendon junction morphology, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
thigmotaxis disrupted, abnormal WT + MO1-col6a1 standard conditions Fig. 3 from Zulian et al., 2014
thigmotaxis process quality, ameliorated WT + MO1-col6a1 chemical treatment by environment: pterostilbene Figure 6 with image from La Spina et al., 2021
muscle cell myofibril kinked, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
muscle cell mitochondrion increased size, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
trunk skeletal muscle organization quality, ameliorated WT + MO1-col6a1 chemical treatment by environment: pterostilbene Figure 6 with image from La Spina et al., 2021
larval locomotory behavior process quality, ameliorated WT + MO1-col6a1 chemical treatment by environment: pterostilbene Figure 6 with image from La Spina et al., 2021
whole organism paralysed, abnormal WT + MO1-col6a1 standard conditions Fig. 2 from Zulian et al., 2014
muscle cell mitochondrial crista decreased amount, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
trunk skeletal muscle organization quality, abnormal WT + MO1-col6a1 control Figure 6 with image from La Spina et al., 2021
muscle T-tubule dilated, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
whole organism decreased mobility, abnormal WT + MO1-col6a1 standard conditions Fig. 2 from Zulian et al., 2014
muscle cell myofibril separated from muscle cell muscle tendon junction, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
muscle cell myofibril misaligned with muscle cell myofibril, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
thigmotaxis decreased process quality, abnormal WT + MO1-col6a1 control Figure 6 with image from La Spina et al., 2021
whole organism decreased size, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.