Morpholino

MO3-etv4

ID
ZDB-MRPHLNO-100623-11
Name
MO3-etv4
Previous Names
  • MO3-pea3 (1)
Target
Sequence
5' - ATCCATGCCTTAACCGTTTGTGGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-etv4
No data available
Phenotype
Phenotype resulting from MO3-etv4
No data available
Phenotype of all Fish created by or utilizing MO3-etv4
Phenotype Fish Conditions Figures
determination of left/right symmetry disrupted, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 6 with image from Znosko et al., 2010
determination of heart left/right asymmetry disrupted, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 5 with image from Znosko et al., 2010
anterior lateral plate mesoderm nkx2.5 expression decreased amount, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 4 with image from Znosko et al., 2010
anterior lateral plate mesoderm tal1 expression increased distribution, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 4 with image from Znosko et al., 2010
anterior lateral plate mesoderm tal1 expression increased amount, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 4 with image from Znosko et al., 2010
presumptive cardiac ventricle heart tube myh7 expression spatial pattern, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 5 with image from Znosko et al., 2010
anterior lateral plate mesoderm gata4 expression decreased amount, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 4 with image from Znosko et al., 2010
heart development disrupted, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 5 with image from Znosko et al., 2010
midbrain hindbrain boundary pax2a expression decreased amount, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 3 with image from Znosko et al., 2010
lateral plate mesoderm left side spaw expression decreased amount, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 6 with image from Znosko et al., 2010
midbrain hindbrain boundary dusp6 expression decreased amount, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 2 with image from Znosko et al., 2010
midbrain hindbrain boundary her5 expression decreased amount, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 3 with image from Znosko et al., 2010
heart looping process quality, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 5 with image from Znosko et al., 2010
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 6 with image from Znosko et al., 2010
presumptive atrium heart tube myh6 expression spatial pattern, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 5 with image from Znosko et al., 2010
anterior lateral plate mesoderm hand2 expression decreased amount, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 4 with image from Znosko et al., 2010
midbrain hindbrain boundary morphology, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 2 with image from Znosko et al., 2010
heart myl7 expression spatial pattern, abnormal AB + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 5 with image from Znosko et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal pt6Tg + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 6 with image from Znosko et al., 2010
Kupffer's vesicle cilium assembly disrupted, abnormal pt6Tg + MO2-etv5a + MO3-etv4 + MO3-etv5a,etv5b + MO3-etv5b standard conditions Fig. 6 with image from Znosko et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.