Morpholino

MO1-fgf2

ID

ZDB-MRPHLNO-100621-9

Name

MO1-fgf2

Previous Names

None

Target

Sequence

5' - GGCCATCCCTAAGTCTGTCGGTCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fgf2

Expressed Gene	Anatomy	Figures
sdc2	whole organism	Fig. S2 from Arrington et al., 2013
tbx16	forerunner cell group margin	Fig. S2 from Arrington et al., 2013

Phenotype

Phenotype resulting from MO1-fgf2

Phenotype	Fish	Figures
brain apoptotic, abnormal	WT + MO1-fgf2	Fig. 6 from Lee et al., 2010
determination of left/right asymmetry in lateral mesoderm process quality, abnormal	AB + MO1-fgf2	Fig. 4 from Arrington et al., 2013
forerunner cell group malformed, abnormal	AB + MO1-fgf2	Fig. S2 from Arrington et al., 2013
Kupffer's vesicle decreased size, abnormal	AB + MO1-fgf2	Fig. 4 from Arrington et al., 2013
Kupffer's vesicle malformed, abnormal	AB + MO1-fgf2	Fig. 4 from Arrington et al., 2013
Kupffer's vesicle motile cilium decreased amount, abnormal	AB + MO1-fgf2	Fig. 4 from Arrington et al., 2013
Kupffer's vesicle development process quality, abnormal	AB + MO1-fgf2	Fig. 4 from Arrington et al., 2013
whole organism lethal (sensu genetics), abnormal	WT + MO1-fgf2	Fig. 6 from Lee et al., 2010

Phenotype of all Fish created by or utilizing MO1-fgf2

Phenotype	Fish	Conditions	Figures
forerunner cell group malformed, abnormal	AB + MO1-fgf2	standard conditions	Fig. S2 from Arrington et al., 2013
Kupffer's vesicle motile cilium decreased amount, abnormal	AB + MO1-fgf2	standard conditions	Fig. 4 from Arrington et al., 2013
determination of left/right asymmetry in lateral mesoderm process quality, abnormal	AB + MO1-fgf2	standard conditions	Fig. 4 from Arrington et al., 2013
Kupffer's vesicle development process quality, abnormal	AB + MO1-fgf2	standard conditions	Fig. 4 from Arrington et al., 2013
Kupffer's vesicle decreased size, abnormal	AB + MO1-fgf2	standard conditions	Fig. 4 from Arrington et al., 2013
Kupffer's vesicle malformed, abnormal	AB + MO1-fgf2	standard conditions	Fig. 4 from Arrington et al., 2013
brain apoptotic, abnormal	WT + MO1-fgf2	standard conditions	Fig. 6 from Lee et al., 2010
whole organism lethal (sensu genetics), abnormal	WT + MO1-fgf2	standard conditions	Fig. 6 from Lee et al., 2010
determination of left/right asymmetry in lateral mesoderm process quality, abnormal	AB + MO1-fgf2 + MO3-tbx16	standard conditions	Fig. 5 from Arrington et al., 2013
determination of left/right asymmetry in lateral mesoderm process quality, abnormal	AB + MO1-fgf2 + MO5-sdc2	standard conditions	Fig. 4 from Arrington et al., 2013

Citations