Morpholino

MO1-mtmr14

ID

ZDB-MRPHLNO-100613-1

Name

MO1-mtmr14

Previous Names

None

Target

mtmr14 (1)

Sequence

5' - TACTGAACAAATACCTACCGCCCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-mtmr14

No data available

Phenotype

Phenotype resulting from MO1-mtmr14

Phenotype	Fish	Figures
musculoskeletal movement, spinal reflex action disrupted, abnormal	WT + MO1-mtmr14	Fig. 1 from Dowling et al., 2010
post-vent region morphology, abnormal	WT + MO1-mtmr14	Fig. 3 from Dowling et al., 2010
trunk morphology, abnormal	WT + MO1-mtmr14	Fig. 3 from Dowling et al., 2010

Phenotype of all Fish created by or utilizing MO1-mtmr14

Phenotype	Fish	Conditions	Figures
trunk morphology, abnormal	WT + MO1-mtmr14	standard conditions	Fig. 3 from Dowling et al., 2010
musculoskeletal movement, spinal reflex action disrupted, abnormal	WT + MO1-mtmr14	standard conditions	Fig. 1 from Dowling et al., 2010
post-vent region morphology, abnormal	WT + MO1-mtmr14	standard conditions	Fig. 3 from Dowling et al., 2010
skeletal muscle cell nucleus irregular spatial pattern, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 7 from Dowling et al., 2010
skeletal muscle cell sarcoplasm disorganized, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 8 from Dowling et al., 2010
whole organism edematous, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
post-vent region bent, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
skeletal muscle cell vacuole morphology, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 8 from Dowling et al., 2010
autophagy increased occurrence, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 9 from Dowling et al., 2010
head hypoplastic, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
skeletal muscle cell morphology, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 7 from Dowling et al., 2010
trunk hypoplastic, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
skeletal muscle cell mitochondrion morphology, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 8 from Dowling et al., 2010
skeletal muscle cell endoplasmic reticulum decreased mass density, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 8 from Dowling et al., 2010
whole organism decreased length, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
extension aplastic, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
whole organism decreased size, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010
whole organism morphology, abnormal	WT + MO1-mtmr14 + MO3-mtm1	standard conditions	Fig. 6 from Dowling et al., 2010

Citations