Morpholino

MO2-dok7b

ID

ZDB-MRPHLNO-100602-6

Name

MO2-dok7b

Previous Names

MO2-dok7
zDok-7 exon 2 splice MO2 (1)

Target

dok7b (1)

Sequence

5' - ATTTATAGGATTTACCTGCTACCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-dok7b

Expressed Gene	Anatomy	Figures
chrna1	myotome acetylcholine-gated channel complex	Fig. 4, Fig. 5 from Müller et al., 2010

Phenotype

Phenotype resulting from MO2-dok7b

Phenotype	Fish	Figures
locomotion decreased occurrence, abnormal	WT + MO2-dok7b	Fig. 4, Fig. 5 from Müller et al., 2010
myotome malformed, abnormal	WT + MO2-dok7b	Fig. 5 from Müller et al., 2010
myotome neuromuscular junction decreased amount, abnormal	WT + MO2-dok7b	Fig. 4 from Müller et al., 2010
myotome neuromuscular junction decreased size, abnormal	WT + MO2-dok7b	Fig. 4 from Müller et al., 2010
myotome slow muscle cell misaligned with myotome slow muscle cell, abnormal	WT + MO2-dok7b	Fig. 5 from Müller et al., 2010
neuromuscular junction development decreased occurrence, abnormal	WT + MO2-dok7b	Fig. 4 from Müller et al., 2010
post-vent region decreased length, abnormal	WT + MO2-dok7b	Fig. 3 from Müller et al., 2010
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal	WT + MO2-dok7b	Fig. 4 from Müller et al., 2010
slow muscle cell curved, abnormal	WT + MO2-dok7b	Fig. 5 from Müller et al., 2010

Phenotype of all Fish created by or utilizing MO2-dok7b

Phenotype	Fish	Conditions	Figures
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal	WT + MO2-dok7b	standard conditions	Fig. 4 from Müller et al., 2010
myotome malformed, abnormal	WT + MO2-dok7b	standard conditions	Fig. 5 from Müller et al., 2010
myotome slow muscle cell misaligned with myotome slow muscle cell, abnormal	WT + MO2-dok7b	standard conditions	Fig. 5 from Müller et al., 2010
post-vent region decreased length, abnormal	WT + MO2-dok7b	standard conditions	Fig. 3 from Müller et al., 2010
locomotion decreased occurrence, abnormal	WT + MO2-dok7b	standard conditions	Fig. 4, Fig. 5 from Müller et al., 2010
slow muscle cell curved, abnormal	WT + MO2-dok7b	standard conditions	Fig. 5 from Müller et al., 2010
neuromuscular junction development decreased occurrence, abnormal	WT + MO2-dok7b	standard conditions	Fig. 4 from Müller et al., 2010
myotome neuromuscular junction decreased size, abnormal	WT + MO2-dok7b	standard conditions	Fig. 4 from Müller et al., 2010
myotome neuromuscular junction decreased amount, abnormal	WT + MO2-dok7b	standard conditions	Fig. 4 from Müller et al., 2010
horizontal myoseptum neuromuscular junction morphology, ameliorated	slc24a5^b1/+ + MO2-dok7b	chemical treatment by environment: albuterol	Fig. 2 from McMacken et al., 2018
whole organism decreased mobility, abnormal	slc24a5^b1/+ + MO2-dok7b	standard conditions	Fig. 1 from McMacken et al., 2018
thigmotaxis process quality, ameliorated	slc24a5^b1/+ + MO2-dok7b	chemical treatment by environment: albuterol	Fig. 1 from McMacken et al., 2018
thigmotaxis disrupted, abnormal	slc24a5^b1/+ + MO2-dok7b	standard conditions	Fig. 1 from McMacken et al., 2018
myotome cholinergic synapse decreased amount, abnormal	slc24a5^b1/+ + MO2-dok7b	standard conditions	Fig. 2 from McMacken et al., 2018
myotome cholinergic synapse amount, ameliorated	slc24a5^b1/+ + MO2-dok7b	chemical treatment by environment: albuterol	Fig. 2 from McMacken et al., 2018
whole organism mobility, ameliorated	slc24a5^b1/+ + MO2-dok7b	chemical treatment by environment: albuterol	Fig. 1 from McMacken et al., 2018
horizontal myoseptum neuromuscular junction morphology, abnormal	slc24a5^b1/+ + MO2-dok7b	standard conditions	Fig. 2 from McMacken et al., 2018

Citations