Morpholino

MO1-hmcn2

ID
ZDB-MRPHLNO-100528-8
Name
MO1-hmcn2
Previous Names
  • hmcn2-atg-1 (1)
Target
Sequence
5' - TAACGACAAACTTTTTCATTCTCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hmcn2
Expressed Gene Anatomy Figures
hmcn2 Fig. 1 with image from Martins Feitosa et al., 2012
Phenotype
Phenotype resulting from MO1-hmcn2
No data available
Phenotype of all Fish created by or utilizing MO1-hmcn2
Phenotype Fish Conditions Figures
dermis fibrillar collagen trimer disorganized, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 3 with image from Martins Feitosa et al., 2012
trunk dermis malformed, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 3 with image from Martins Feitosa et al., 2012
post-vent region integument blistered, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 2 with image from Martins Feitosa et al., 2012
trunk integument blistered, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 2 with imageFig. 3 with image from Martins Feitosa et al., 2012
dermis fibrillar collagen trimer decreased amount, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 3 with image from Martins Feitosa et al., 2012
dorsal actinotrichium separated from dorsal fin fold mesenchymal cell, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 5 with image from Martins Feitosa et al., 2012
skin morphogenesis decreased process quality, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 2 with imageFig. 3 with image from Martins Feitosa et al., 2012
dermis separated from epidermis, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 3 with image from Martins Feitosa et al., 2012
embryonic medial fin morphogenesis decreased process quality, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 5 with image from Martins Feitosa et al., 2012
collagen fibril organization decreased process quality, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 3 with image from Martins Feitosa et al., 2012
dorsal fin fold microfibril disorganized, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 5 with image from Martins Feitosa et al., 2012
dorsal fin fold mesenchymal cell mislocalised, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 5 with image from Martins Feitosa et al., 2012
mesenchymal cell migration decreased process quality, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 5 with image from Martins Feitosa et al., 2012
dorsal fin fold dermis malformed, abnormal WT + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 5 with image from Martins Feitosa et al., 2012
post-vent region integument blistered, abnormal WT + MO1-hmcn2 + MO3-fbln1 + MO4-fbln1 standard conditions Fig. 2 with image from Martins Feitosa et al., 2012
skin morphogenesis decreased process quality, abnormal WT + MO1-hmcn2 + MO3-fbln1 + MO4-fbln1 standard conditions Fig. 2 with image from Martins Feitosa et al., 2012
trunk integument blistered, abnormal WT + MO1-hmcn2 + MO3-fbln1 + MO4-fbln1 standard conditions Fig. 2 with image from Martins Feitosa et al., 2012
median fin fold decreased height, abnormal sqet37Et + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 4 with image from Martins Feitosa et al., 2012
embryonic medial fin morphogenesis decreased process quality, abnormal sqet37Et + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 4 with image from Martins Feitosa et al., 2012
median fin fold mesenchymal cell decreased branchiness, abnormal sqet37Et + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 4 with image from Martins Feitosa et al., 2012
mesenchyme median fin fold mislocalised, abnormal sqet37Et + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 4 with image from Martins Feitosa et al., 2012
mesenchymal cell migration decreased process quality, abnormal sqet37Et + MO1-fbln1 + MO1-hmcn2 standard conditions Fig. 4 with image from Martins Feitosa et al., 2012
Citations