Morpholino

MO2-plxnd1

ID

ZDB-MRPHLNO-100521-6

Name

MO2-plxnd1

Previous Names

plxnD1 3207-3462 (1)

Target

plxnd1 (1)

Sequence

5' - CACACACACTCACGTTGATGATGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-plxnd1

No data available

Phenotype

Phenotype resulting from MO2-plxnd1

Phenotype	Fish	Figures
blood circulation process quality, abnormal	y1Tg + MO2-plxnd1	Fig. 2 from Torres-Vazquez et al., 2004
blood vessel remodeling disrupted, abnormal	WT + MO2-plxnd1	text only from Torres-Vazquez et al., 2004
branching involved in blood vessel morphogenesis disrupted, abnormal	y1Tg + MO2-plxnd1	Fig. 2 from Torres-Vazquez et al., 2004
caudal vein morphology, abnormal	WT + MO2-plxnd1	text only from Torres-Vazquez et al., 2004
common cardinal vein increased width, abnormal	mu240Tg + MO2-plxnd1	Fig. 7 from Hamm et al., 2016
facial lymphatic network lymphatic endothelial cluster DsRed expression increased amount, abnormal	nz150Tg/nz150Tg; y7Tg/y7Tg + MO2-plxnd1	Fig. 4 from Britto et al., 2022
facial lymphatic network lymphatic endothelial cluster ab9-mapk labeling increased amount, abnormal	nz101Tg/nz101Tg; y7Tg/y7Tg + MO2-plxnd1	Fig. 5 from Britto et al., 2022
facial lymphatic vessel DsRed expression spatial pattern, abnormal	nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1	Fig. 1 from Britto et al., 2022
intersegmental vessel increased branchiness, abnormal	y1Tg + MO2-plxnd1	Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel morphology, abnormal	y1Tg + MO2-plxnd1	Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel EGFP expression spatial pattern, abnormal	nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1	Fig. 1 from Britto et al., 2022
intersegmental vessel spatial pattern, abnormal	y1Tg + MO2-plxnd1	Fig. 2 from Torres-Vazquez et al., 2004
sprouting angiogenesis disrupted, abnormal	y1Tg + MO2-plxnd1	Fig. 2 from Torres-Vazquez et al., 2004
trunk lymph vasculature misaligned with trunk intersegmental vessel, abnormal	nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1	Fig. 1 from Britto et al., 2022
trunk lymphatic system DsRed expression spatial pattern, abnormal	nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1	Fig. 1 from Britto et al., 2022
trunk vasculature lymphatic endothelial cluster ab9-mapk labeling increased amount, abnormal	nz101Tg/nz101Tg; y7Tg/y7Tg + MO2-plxnd1	Fig. 5 from Britto et al., 2022
trunk vasculature sprouting angiogenesis increased occurrence, abnormal	y1Tg + MO2-plxnd1	Figure 6. from Carretero-Ortega et al., 2019
venous blood vessel morphogenesis decreased process quality, abnormal	s843Tg + MO2-plxnd1	Fig. 7 from Hamm et al., 2016

Phenotype of all Fish created by or utilizing MO2-plxnd1

Phenotype	Fish	Conditions	Figures
blood vessel remodeling disrupted, abnormal	WT + MO2-plxnd1	standard conditions	text only from Torres-Vazquez et al., 2004
caudal vein morphology, abnormal	WT + MO2-plxnd1	standard conditions	text only from Torres-Vazquez et al., 2004
venous blood vessel morphogenesis decreased process quality, abnormal	mu240Tg + MO2-plxnd1	standard conditions	Fig. 7 from Hamm et al., 2016
common cardinal vein increased width, abnormal	mu240Tg + MO2-plxnd1	standard conditions	Fig. 7 from Hamm et al., 2016
venous blood vessel morphogenesis decreased process quality, abnormal	s843Tg + MO2-plxnd1	standard conditions	Fig. 7 from Hamm et al., 2016
common cardinal vein increased width, abnormal	s843Tg + MO2-plxnd1	standard conditions	Fig. 7 from Hamm et al., 2016
sprouting angiogenesis disrupted, abnormal	y1Tg + MO2-plxnd1	standard conditions	Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel morphology, abnormal	y1Tg + MO2-plxnd1	standard conditions	Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel spatial pattern, abnormal	y1Tg + MO2-plxnd1	standard conditions	Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel increased branchiness, abnormal	y1Tg + MO2-plxnd1	standard conditions	Fig. 2 from Torres-Vazquez et al., 2004
blood circulation process quality, abnormal	y1Tg + MO2-plxnd1	standard conditions	Fig. 2 from Torres-Vazquez et al., 2004
branching involved in blood vessel morphogenesis disrupted, abnormal	y1Tg + MO2-plxnd1	standard conditions	Fig. 2 from Torres-Vazquez et al., 2004
trunk vasculature sprouting angiogenesis increased occurrence, abnormal	y1Tg + MO2-plxnd1	control	Figure 6. from Carretero-Ortega et al., 2019
trunk lymph vasculature misaligned with trunk intersegmental vessel, abnormal	nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1	standard conditions	Fig. 1 from Britto et al., 2022
trunk lymphatic system DsRed expression spatial pattern, abnormal	nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1	standard conditions	Fig. 1 from Britto et al., 2022
intersegmental vessel EGFP expression spatial pattern, abnormal	nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1	standard conditions	Fig. 1 from Britto et al., 2022
facial lymphatic vessel DsRed expression spatial pattern, abnormal	nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1	standard conditions	Fig. 1 from Britto et al., 2022
trunk vasculature lymphatic endothelial cluster ab9-mapk labeling increased amount, abnormal	nz101Tg/nz101Tg; y7Tg/y7Tg + MO2-plxnd1	standard conditions	Fig. 5 from Britto et al., 2022
facial lymphatic network lymphatic endothelial cluster ab9-mapk labeling increased amount, abnormal	nz101Tg/nz101Tg; y7Tg/y7Tg + MO2-plxnd1	standard conditions	Fig. 5 from Britto et al., 2022
facial lymphatic network lymphatic endothelial cluster DsRed expression increased amount, abnormal	nz150Tg/nz150Tg; y7Tg/y7Tg + MO2-plxnd1	standard conditions	Fig. 4 from Britto et al., 2022
trunk vasculature sprouting angiogenesis increased occurrence, abnormal	gipc1^skt1/skt1; gipc2^skt4/skt4; y1Tg + MO2-plxnd1	control	Figure 6. from Carretero-Ortega et al., 2019

Citations