Morpholino

MO1-cul4a

ID

ZDB-MRPHLNO-100503-4

Name

MO1-cul4a

Previous Names

None

Target

Sequence

5' - CTGGTGCTGAACATCTTCTGCCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cul4a

Expressed Gene	Anatomy	Figures
fgf8a	fin fold pectoral fin bud	Fig. S14 from Ito et al., 2010
shha	pectoral fin bud	Fig. S14 from Ito et al., 2010

Phenotype

Phenotype resulting from MO1-cul4a

Phenotype	Fish	Figures
apical ectodermal ridge pectoral fin bud physical object quality, abnormal	WT + MO1-cul4a	Fig. S14 from Ito et al., 2010
embryonic pectoral fin morphogenesis process quality, abnormal	WT + MO1-cul4a	Fig. 4, Fig. S14 from Ito et al., 2010
forebrain primary neuron ab1-tuba labeling decreased amount, abnormal	WT + MO1-cul4a	Fig. 2 from Ando et al., 2019
head decreased size, abnormal	WT + MO1-cul4a	Fig. 2 from Ando et al., 2019
otic vesicle decreased size, abnormal	WT + MO1-cul4a	Fig. 4, Fig. S14 from Ito et al., 2010
otic vesicle morphogenesis process quality, abnormal	WT + MO1-cul4a	Fig. 4, Fig. S14 from Ito et al., 2010
pectoral fin decreased size, abnormal	WT + MO1-cul4a	Fig. 4 from Ito et al., 2010
pectoral fin malformed, abnormal	WT + MO1-cul4a	Fig. 4 from Ito et al., 2010

Phenotype of all Fish created by or utilizing MO1-cul4a

Phenotype	Fish	Conditions	Figures
otic vesicle morphogenesis process quality, abnormal	WT + MO1-cul4a	standard conditions	Fig. 4, Fig. S14 from Ito et al., 2010
head decreased size, abnormal	WT + MO1-cul4a	control	Fig. 2 from Ando et al., 2019
forebrain primary neuron ab1-tuba labeling decreased amount, abnormal	WT + MO1-cul4a	control	Fig. 2 from Ando et al., 2019
embryonic pectoral fin morphogenesis process quality, abnormal	WT + MO1-cul4a	standard conditions	Fig. 4, Fig. S14 from Ito et al., 2010
apical ectodermal ridge pectoral fin bud physical object quality, abnormal	WT + MO1-cul4a	standard conditions	Fig. S14 from Ito et al., 2010
pectoral fin decreased size, abnormal	WT + MO1-cul4a	standard conditions	Fig. 4 from Ito et al., 2010
pectoral fin malformed, abnormal	WT + MO1-cul4a	standard conditions	Fig. 4 from Ito et al., 2010
otic vesicle decreased size, abnormal	WT + MO1-cul4a	standard conditions	Fig. 4, Fig. S14 from Ito et al., 2010
head decreased size, abnormal	WT + MO1-cul4a + MO2-cul4b	control	Fig. 2 from Ando et al., 2019
forebrain primary neuron ab1-tuba labeling decreased amount, abnormal	WT + MO1-cul4a + MO2-cul4b	control	Fig. 2 from Ando et al., 2019

Citations