Morpholino

MO1-nos1

ID
ZDB-MRPHLNO-100503-12
Name
MO1-nos1
Previous Names
None
Target
Sequence
5' - ACGCTGGGCTCTGATTCCTGCATTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nos1
Expressed Gene Anatomy Figures
fabp10a Fig. 2 with image from Cox et al., 2014
foxa3 Fig. 2 with image from Cox et al., 2014
myb Fig. 5 with image from North et al., 2009
nos1 Fig. 3 from Bradley et al., 2010
runx1 Fig. 5 with image from North et al., 2009
Phenotype
Phenotype resulting from MO1-nos1
Phenotype Fish Figures
collateral sprouting increased occurrence, abnormal WT + MO1-nos1 Fig. 3 from Bradley et al., 2010
hematopoietic stem cell decreased amount, abnormal WT + MO1-nos1 Fig. 5 with image from North et al., 2009
larval locomotory behavior amplitude, abnormal WT + MO1-nos1 Fig. 12 from Bradley et al., 2010
larval locomotory behavior increased frequency, abnormal WT + MO1-nos1 Fig. 12 from Bradley et al., 2010
liver decreased size, abnormal WT + MO1-nos1 Fig. 2 with image from Cox et al., 2014
liver development decreased process quality, abnormal WT + MO1-nos1 Fig. 2 with image from Cox et al., 2014
motor neuron decreased amount, abnormal WT + MO1-nos1 Fig. 8 from Bradley et al., 2010
motor neuron axon collateral increased amount, abnormal WT + MO1-nos1 Fig. 3 from Bradley et al., 2010
whole organism increased speed, abnormal WT + MO1-nos1 Fig. 12 from Bradley et al., 2010
Phenotype of all Fish created by or utilizing MO1-nos1
Phenotype Fish Conditions Figures
liver development decreased process quality, abnormal WT + MO1-nos1 standard conditions Fig. 2 with image from Cox et al., 2014
collateral sprouting increased occurrence, abnormal WT + MO1-nos1 standard conditions Fig. 3 from Bradley et al., 2010
respiratory system process decreased frequency, abnormal WT + MO1-nos1 hypoxia Fig. 3 from Porteus et al., 2015
hematopoietic stem cell decreased amount, abnormal WT + MO1-nos1 standard conditions Fig. 5 with image from North et al., 2009
liver decreased size, abnormal WT + MO1-nos1 standard conditions Fig. 2 with image from Cox et al., 2014
motor neuron axon collateral increased amount, abnormal WT + MO1-nos1 standard conditions Fig. 3 from Bradley et al., 2010
larval locomotory behavior increased frequency, abnormal WT + MO1-nos1 standard conditions Fig. 12 from Bradley et al., 2010
whole organism increased speed, abnormal WT + MO1-nos1 standard conditions Fig. 12 from Bradley et al., 2010
larval locomotory behavior amplitude, abnormal WT + MO1-nos1 standard conditions Fig. 12 from Bradley et al., 2010
motor neuron decreased amount, abnormal WT + MO1-nos1 standard conditions Fig. 8 from Bradley et al., 2010
liver has fewer parts of type hepatocyte, abnormal mitfaw2/w2; mpv17a9/a9; as3Tg + MO1-nos1 standard conditions Fig. 2 with image from Cox et al., 2014
liver decreased size, abnormal mitfaw2/w2; mpv17a9/a9; as3Tg + MO1-nos1 standard conditions Fig. 2 with image from Cox et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.