Morpholino

MO1-uchl5

ID

ZDB-MRPHLNO-100225-33

Name

MO1-uchl5

Previous Names

None

Target

Sequence

5' - ATTCCCCAGCGCTTCCCGCCATTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-uchl5

No data available

Phenotype

Phenotype resulting from MO1-uchl5

Phenotype	Fish	Figures
central nervous system necrotic, abnormal	AB + MO1-uchl5	Fig. S4 from Tse et al., 2009
extension decreased thickness, abnormal	AB + MO1-uchl5	Fig. S4 from Tse et al., 2009
head malformed, abnormal	AB + MO1-uchl5	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-uchl5	Fig. 2 from Tse, 2017
mandibular arch skeleton increased thickness, abnormal	AB + MO1-uchl5	Fig. S4 from Tse et al., 2009
Meckel's cartilage morphology, abnormal	AB + MO1-uchl5	Fig. 2 from Tse, 2017
otolith morphogenesis disrupted, abnormal	AB + MO1-uchl5	Fig. S4 from Tse et al., 2009
pericardium edematous, abnormal	AB + MO1-uchl5	Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal	AB + MO1-uchl5	Fig. 2 from Tse, 2017
post-vent region curled, abnormal	AB + MO1-uchl5	Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal	AB + MO1-uchl5	Fig. S4 from Tse et al., 2009

Phenotype of all Fish created by or utilizing MO1-uchl5

Phenotype	Fish	Conditions	Figures
otolith morphogenesis disrupted, abnormal	AB + MO1-uchl5	standard conditions	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-uchl5	standard conditions	Fig. 2 from Tse, 2017
head malformed, abnormal	AB + MO1-uchl5	standard conditions	Fig. S4 from Tse et al., 2009
pericardium edematous, abnormal	AB + MO1-uchl5	standard conditions	Fig. S4 from Tse et al., 2009
post-vent region curled, abnormal	AB + MO1-uchl5	standard conditions	Fig. S4 from Tse et al., 2009
Meckel's cartilage morphology, abnormal	AB + MO1-uchl5	standard conditions	Fig. 2 from Tse, 2017
mandibular arch skeleton increased thickness, abnormal	AB + MO1-uchl5	standard conditions	Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal	AB + MO1-uchl5	standard conditions	Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal	AB + MO1-uchl5	standard conditions	Fig. 2 from Tse, 2017
extension decreased thickness, abnormal	AB + MO1-uchl5	standard conditions	Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal	AB + MO1-uchl5	standard conditions	Fig. S4 from Tse et al., 2009

Citations