Morpholino

MO1-duox

ID

ZDB-MRPHLNO-091117-1

Name

MO1-duox

Previous Names

MO1-duox1

Target

duox (1)

Sequence

5' - AGTGAATTAGAGAAATGCACCTTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-duox

No data available

Phenotype

Phenotype resulting from MO1-duox

Phenotype	Fish	Figures
cell death increased occurrence, abnormal	AB + MO1-duox	text only from Niethammer et al., 2009
defense response to fungus process quality, abnormal	i114Tg + MO1-duox + MO4-tp53	Fig. 4 , Fig. 5 from Brothers et al., 2013
neutrophil phagocytosis decreased process quality, abnormal	i114Tg + MO1-duox + MO4-tp53	Fig. 4 from Brothers et al., 2013
neutrophil chemotaxis process quality, abnormal	i114Tg + MO1-duox + MO4-tp53	Fig. 4 from Brothers et al., 2013

Phenotype of all Fish created by or utilizing MO1-duox

Phenotype	Fish	Conditions	Figures
kidney Ab3-havcr1 labeling increased amount, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 2 from Chen et al., 2019
renal tubule hydrogen peroxide amount, ameliorated	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 1 from Chen et al., 2019
renal tubule structure, exacerbated	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 2 from Chen et al., 2019
renal tubule apoptotic process increased occurrence, exacerbated	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 2 from Chen et al., 2019
cell death increased occurrence, abnormal	AB + MO1-duox	standard conditions	text only from Niethammer et al., 2009
regenerating tissue kidney lhx1a expression decreased distribution, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 3 from Chen et al., 2019
renal duct Ab4-pax2a labeling decreased amount, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 3 from Chen et al., 2019
regenerating tissue kidney lhx1a expression decreased amount, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 3 from Chen et al., 2019
regenerating tissue renal duct Ab4-pax2a labeling decreased distribution, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 3 from Chen et al., 2019
renal tubule absent, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 2 from Chen et al., 2019
regenerating tissue renal duct Ab4-pax2a labeling decreased amount, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 3 from Chen et al., 2019
regenerating tissue cell population proliferation decreased occurrence, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 3 from Chen et al., 2019
renal tubule animal organ regeneration decreased occurrence, abnormal	AB + MO1-duox	physical alteration: kidney, chemical treatment by injection: gentamycin	Fig. 3 from Chen et al., 2019
response to wounding disrupted, abnormal	AB + MO1-duox + MO4-tp53	physical alteration: caudal fin	Fig. 3 from Niethammer et al., 2009
hydrogen peroxide biosynthetic process disrupted, abnormal	AB + MO1-duox + MO4-tp53	physical alteration: caudal fin	Fig. 3 from Niethammer et al., 2009
leukocyte migration disrupted, abnormal	AB + MO1-duox + MO4-tp53	physical alteration: caudal fin	Fig. 3 from Niethammer et al., 2009
caudal fin fin regeneration decreased occurrence, abnormal	WT + MO1-duox	amputation: caudal fin	Figure 4 from Bernut et al., 2020
leukocyte migration involved in inflammatory response decreased occurrence, abnormal	WT + MO1-duox	chemical treatment: arachidonic acid	Fig. 1 from Katikaneni et al., 2020
inflammatory response to wounding decreased magnitude, abnormal	WT + MO1-duox	amputation: caudal fin	Fig. 2 from Katikaneni et al., 2020
caudal fin neutrophil increased amount, ameliorated	i114Tg + MO1-duox	amputation: caudal fin	Figure 2 from Bernut et al., 2020
neutrophil chemotaxis process quality, abnormal	i114Tg + MO1-duox + MO4-tp53	standard conditions	Fig. 4 from Brothers et al., 2013
neutrophil chemotaxis decreased process quality, abnormal	i114Tg + MO1-duox + MO4-tp53	amputation: caudal fin	Fig. 2 from de Oliveira et al., 2014
neutrophil phagocytosis decreased process quality, abnormal	i114Tg + MO1-duox + MO4-tp53	standard conditions	Fig. 4 from Brothers et al., 2013
defense response to fungus process quality, abnormal	i114Tg + MO1-duox + MO4-tp53	standard conditions	Fig. 4 , Fig. 5 from Brothers et al., 2013
neutrophil chemotaxis decreased process quality, abnormal	nz50Tg + MO1-duox + MO4-tp53	amputation: caudal fin	Fig. 2 from de Oliveira et al., 2014
peptidyl-tyrosine autophosphorylation decreased occurrence, abnormal	uwm5Tg + MO1-duox + MO4-tp53	physical alteration: anatomical structure	Fig. 1 from Yoo et al., 2011
macrophage response to wounding process quality, abnormal	uwm12Tg + MO1-duox + MO4-tp53	amputation: caudal fin	Fig. 3 from Tauzin et al., 2014
macrophage chemotaxis process quality, abnormal	uwm12Tg + MO1-duox + MO4-tp53	amputation: caudal fin	Fig. 3 from Tauzin et al., 2014
regenerating fin caudal fin EGFP expression decreased amount, abnormal	uwm37Tg + MO1-duox + MO4-tp53 (AB)	resection: caudal fin	Fig. 2 S1 from LeBert et al., 2018
caudal fin fin regeneration decreased occurrence, abnormal	WT + MO1-duox + MO7-cftr	amputation: caudal fin	Figure 4 from Bernut et al., 2020
caudal fin neutrophil increased amount, ameliorated	i114Tg + MO1-duox + MO7-cftr	amputation: caudal fin	Figure 2 from Bernut et al., 2020

Citations