Morpholino

MO3-gli2b

ID
ZDB-MRPHLNO-091116-3
Name
MO3-gli2b
Previous Names
  • gli2bMO (1)
Target
Sequence
5' - AGCTGGAACACCGGCCTCCATTCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-gli2b
No data available
Phenotype
Phenotype resulting from MO3-gli2b
Phenotype of all Fish created by or utilizing MO3-gli2b
Phenotype Fish Conditions Figures
prolactin secreting cell increased amount, abnormal WT + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis morphogenesis process quality, abnormal WT + MO3-gli2b standard conditions Fig. 3 with imageFig. 5 with image from Devine et al., 2009
corticotropin hormone secreting cell differentiation process quality, abnormal WT + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell differentiation process quality, abnormal WT + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis physical object quality, abnormal WT + MO3-gli2b standard conditions Fig. 5 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal WT + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
thyroid stimulating hormone secreting cell increased amount, abnormal WT + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis wholly anteriorized, abnormal WT + MO3-gli2b standard conditions Fig. 3 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal WT + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal WT + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
pars anterior physical object quality, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 3 with image from Devine et al., 2009
prolactin secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
corticotropin hormone secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis morphogenesis process quality, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 3 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell decreased amount, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
melanocyte stimulating hormone secreting cell decreased amount, abnormal gli1ts269/ts269 + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
corticotropin hormone secreting cell differentiation process quality, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis wholly anteriorized, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 3 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adenohypophysis morphogenesis process quality, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 3 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell increased amount, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
melanocyte stimulating hormone secreting cell decreased amount, abnormal WT + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
corticotropin hormone secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
adrenocorticotropic hormone secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
prolactin secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
melanocyte stimulating hormone secreting cell decreased amount, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal gli1ts269/ts269 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal WT + MO1-gli1 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal WT + MO1-gli1 + MO1-gli2a + MO3-gli2b standard conditions Fig. 4 with image from Devine et al., 2009
Citations