Morpholino
MO1-lnx2b
- ID
- ZDB-MRPHLNO-090918-1
- Name
- MO1-lnx2b
- Previous Names
-
- lnx-l 5' UTR MO (1)
- Target
- Sequence
-
5' - CCTACGCCTCTTTCACAGCTCACAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lnx2b
Expressed Gene | Anatomy | Figures |
---|---|---|
chrd |
Fig. 1
from Ro et al., 2009 |
|
dharma |
Fig. 5
from Ro et al., 2009 |
|
gsc |
Fig. 1,
Fig. 4,
Fig. 5
from Ro et al., 2009 |
|
vent |
Fig. 1
from Ro et al., 2009 |
|
vox |
Fig. 1
from Ro et al., 2009 |
Phenotype
Phenotype resulting from MO1-lnx2b
Phenotype | Fish | Figures |
---|---|---|
whole organism wholly dorsalized, abnormal | WT + MO1-lnx2b |
Fig. 1,
Fig. 4,
Fig. 5
from Ro et al., 2009 |
Phenotype of all Fish created by or utilizing MO1-lnx2b
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism wholly dorsalized, abnormal | WT + MO1-lnx2b | standard conditions |
Fig. 1,
Fig. 4,
Fig. 5
from Ro et al., 2009 |
Citations