Morpholino

MO1-pycr1a

ID

ZDB-MRPHLNO-090915-6

Name

MO1-pycr1a

Previous Names

MO1-pycr1

Target

pycr1a (1)

Sequence

5' - CAGCTCCGATAAATCCCACACTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pycr1a

No data available

Phenotype

Phenotype resulting from MO1-pycr1a

Phenotype	Fish	Figures
epidermis atrophied, abnormal	WT + MO1-pycr1a	Fig. S5 from Reversade et al., 2009
post-vent region curved, abnormal	WT + MO1-pycr1a	Fig. S5 from Kuo et al., 2016
post-vent region increased curvature, abnormal	WT + MO1-pycr1a	Fig. S5 from Reversade et al., 2009
whole organism apoptotic, abnormal	WT + MO1-pycr1a	Fig. S5 from Reversade et al., 2009
whole organism decreased length, abnormal	WT + MO1-pycr1a	Fig. S5 from Kuo et al., 2016 Fig. S5 from Reversade et al., 2009
whole organism malformed, abnormal	WT + MO1-pycr1a	Fig. S5 from Reversade et al., 2009

Phenotype of all Fish created by or utilizing MO1-pycr1a

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	WT + MO1-pycr1a	standard conditions	Fig. S5 from Kuo et al., 2016 Fig. S5 from Reversade et al., 2009
epidermis atrophied, abnormal	WT + MO1-pycr1a	standard conditions	Fig. S5 from Reversade et al., 2009
post-vent region increased curvature, abnormal	WT + MO1-pycr1a	standard conditions	Fig. S5 from Reversade et al., 2009
post-vent region curved, abnormal	WT + MO1-pycr1a	standard conditions	Fig. S5 from Kuo et al., 2016
whole organism apoptotic, abnormal	WT + MO1-pycr1a	standard conditions	Fig. S5 from Reversade et al., 2009
whole organism malformed, abnormal	WT + MO1-pycr1a	standard conditions	Fig. S5 from Reversade et al., 2009
post-vent region curved, abnormal	WT + MO1-pycr1a + MO1-pycr1b	standard conditions	Fig. S6 from Kuo et al., 2016
whole organism apoptotic, abnormal	WT + MO1-pycr1a + MO1-pycr1b	standard conditions	Fig. S5 from Reversade et al., 2009
embryo development disrupted, abnormal	WT + MO1-pycr1a + MO1-pycr1b	standard conditions	Fig. S6 from Kuo et al., 2016
post-vent region increased curvature, abnormal	WT + MO1-pycr1a + MO1-pycr1b	standard conditions	Fig. S5 from Reversade et al., 2009
whole organism decreased length, abnormal	WT + MO1-pycr1a + MO1-pycr1b	standard conditions	Fig. S6 from Kuo et al., 2016 Fig. S5 from Reversade et al., 2009
whole organism malformed, abnormal	WT + MO1-pycr1a + MO1-pycr1b	standard conditions	Fig. S5 from Reversade et al., 2009
epidermis atrophied, abnormal	WT + MO1-pycr1a + MO1-pycr1b	standard conditions	Fig. S5 from Reversade et al., 2009
somite morphology, abnormal	WT + MO1-pycr1a + MO1-pycr1b	standard conditions	Fig. S6 from Kuo et al., 2016
embryo development disrupted, abnormal	WT + MO1-pycr1a + MO1-pycr3	standard conditions	Fig. S6 from Kuo et al., 2016
whole organism decreased length, abnormal	WT + MO1-pycr1a + MO1-pycr3	standard conditions	Fig. S6 from Kuo et al., 2016
post-vent region curved, abnormal	WT + MO1-pycr1a + MO1-pycr3	standard conditions	Fig. S6 from Kuo et al., 2016
somite morphology, abnormal	WT + MO1-pycr1a + MO1-pycr3	standard conditions	Fig. S6 from Kuo et al., 2016

Citations